Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1851
Length(NT) : 695
Best Gene Model Blast : Link to GSTUMT00002341001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG05556.1
Accession: ref|XP_385732.1| Score: 157 E_value: 4e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG05556.1 Score: 157 E_value: 2e-09
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG3118 Score: 153 E_value: 3e-11
PFAM Definition: No Hit Found

Sequence:
>Contig1851
GCAACTTCATCCCCAGCAGTAAGCACAGCGAAGTACATACTCAAAACCCC
CAAATACGCACTCAGTGCCCTAAACTTGACGATAGCCACAGAGCTCCTAA
CCGTCTCACCAACCGCCTCCGCTGCTGCGGCCGAGAGTCCCAGTGACGCA
TGCAGCGGCTCTAACTCCGAAAACTCCTTCGCAAGGAGTGGAAATTCGGG
GTGGAGGAGGTGGAGGCGCTTTGTCCTCTCCTCCTCAGACAAGGAGGATA
AAGGAACGGAGGGGAGCTGTTCAATTACTTTTGCTACCGTCGTGGAAGCG
ATGGGGGAAGGGGGATCGGCGATAGTCCATTCAGCAGCATTGAACAAAAA
GTCATTAGCGGAGAGTGATGACAGGTGCCTAGATTGCAACCTTAACGCCT
CAGATTCTTCAGCTTCTTCGGGGGCGCTAGGGTCGTTGTAGTAGTCTTTC
CTGGAGCTTCCCCAGCCTTCTAGTAGCTCCTCGTCCTCTTCGCCTTTCTC
GGCATCACTGTCCCCGTCGCTCGTACCTTCATCCTGATCGGAATACCTCA
ACCCAAGAACTTCCTCATCGCTAGGTCCGTCCTCATCAAAAACATCATCC
TCCAGGAGCACCTTATCCCTCGATATGTGAAAAGCGTCTTCCTCGTCCGC
GACGTCTTCCCATGTTCCAATCGGACCAATCTTTGCGTCATCCAA

Sequences in the Contig:

SY0AAA6YI22FM1 SY0AAC7YF23FM1