Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1850
Length(NT) : 2386
Best Gene Model Blast : Link to GSTUMT00007815001 E-value : 0.0
Numbers of ESTs : 26

Blast Results:

Nr Definition: hypothetical protein SNOG_04252
Accession: ref|XP_001794672.1| Score: 811 E_value: 3e-84
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1850
TTGGGCGGAATCTAATCTATGGAAGAAAGGGAGAAAAGCCAGTCGGACCA
GCATAGGCTGGGAGTGGAAAGACGGACAAGGCGCGGTAGGGTACCTGCAC
TGTACGAGTACGGTACTCGAGCACGGTACCGGTACAGTACAACCGGTGAA
AAGATCACCCATTGGCCCCTTTCGCCCACCATGACAGGGTCTAAACTCCA
CTCGACGACCTCGCATCAGACCCATCGTGGCGAGAACCAGACCGTAACCT
ACGACACAACTCCTAGCTTCTTGCACTGTACCTTAAGGGATTGCCAAAGT
GCGGACAAGACGAGTCAGGAGGGCGGATAGCAGGCCCCCTGTCTGCCCCG
GACGACGGCTCTCACTCTCGCCTAGGCCCGCCGTTAGGGGTAACGCTTTA
GTCAAGCTCAACAAAAATGCATGCCATCATTACCGACCCTTTAACTTACC
CTTGGCTCGCCTTTTTTTTTTCTGCCTTGCCCTGTCTTCCACGGCAAGTT
ACTGTGGATGGTTTGGGGTGGTGGGCACTATAGCGTGCTAATTACGTTTT
TGCAGGAACGCATCGTGACTTACGGAGTAAAGATTCGTCGACTCGTCGGT
CATAAGTCCAATGCACCGTGCTAGGGGGAAAGTTGGTAGGGAGGAAAGGG
AGGGACTTGTGGCTTGTGCTCGATTATCTCTCCACATACCAACCTATTCA
TACTTTCTCATACTGCTCTTCTACACCCCATGCATCGATAGATATCCACG
CCGTAATGCCATCAATCGAAGATCTCCCCTTCGAGATACTCTCGGACATT
CTCTCCATCGCAGCCCAGTTAAACTCCACCGACACCCCCAGCTATACTTA
TGGCCTTACGCAGGCGCAGAGGACTTTGCAGAGGACGCAGACACAGATAT
ACCTCCGTGGACGAACAACCCCAGATGTGCTGCGTTGGCACCTGGTCAAC
AGCTTCCGCCTTGTGAATTCAAGATGGCACGAGTGGGCGTTGGGATATGC
CATGAGGGAGATATACGTCCGGAAGTGGAGGGGTGGTGAACGCTGGCTAT
ACAAAAGTACCGAAGAGCAAACCCGAAGTTCTGCCGCCGCCGGTGTATTC
CCGGTAGTCTATCAACACCCGTACTCTTCCGTCAAGTCCACCATATCCCT
CCTCCGCGACTACCCGCACATCGCGCAGCACGTCCGCAGAGTCTGGTTCA
ATGGGATCTATCATTTCGACACGAGTAGATACATATTCGATATACTCGGA
AATTGTACCGGCCTACACACAGCCGCGATTCCATGGACTTCCTTGCGTTA
CGGGACGGAGGAGGACTGGAAGAACTTGATGTCGTTTCCTCAATTGACGA
GTATCGAGTTCTTGGCGGTGGATCTGGAGGACTCGCTTGTTTCTGCTGAG
GTTAACCGCACAGATAATAACATCCTTTTGTCGCTGGACTTCTCACGGAT
CACAAGGTTAAAGATATTCGGGGACTCGAACCTTTTGCCCATTACCGACG
ACGACCTAATCACTATTTCCCGTACCGCGACGTCCCTACAGGAAATCCAC
ATTACTAGCTCTACCTCAATCACTATCAAGGGCCTTGCAGCGTTGGTCTC
AGCGTCGCGCACATCCCTAAAGCTCCTGGAATACAAACCCCTGTCTGACT
CGGGCTTCACTCACCCTTCCTCCGTCGAATCCCACCCGCAAATCCACATT
TGCACACTTTTATCTTCCTGCCCCAAACTCGAAGACCTGGCCATTACTCT
CCCAACCGCGTGTCCGGAACTGTTCTCGCGTCACTCTGTCGCCTGGCACG
AAACGGTCCGTCTGCGCATCGCCGGAAGCGGCGTATGTCGTTTCTCAACG
GTCGACGAGAACATTGCGGAGTTCAGTAAGCTTCTTGAAGGCGCACGGGA
GCTTCTCGGCGTGAAGAGGGATCTTGGCGTAGAAATTTCCGTGGGGAAGT
TTCTATTCGACACAAAGACTCGCCTAGTTCACGGGAATTATAAAAGTGCA
AAGGTGGTTAGCGAGATGGGGTGGGGACCCGTGGAGCATGTCTCGCTCAA
GGGACCGTATGGTGCTACGGGGTTGTATGGGGATGACGATGTCAAGGGGG
AGTGGAGCGCCATTTCCGAAGAGGAGTTTTGGGAGGGGATGAGGTGGGGA
TTTGTCAAGTTCGATAGCTAATCTAGTCTGAGCCCGTCTGTATGGGTAGG
AAAAGAGATGCTGATTACAATTGGAATTGGAAACGGAACTGGAAAAAGTG
GGCATCTTTGTTACTTTTTTGCTATTATGCCGGATTATCATTGTCTGCTG
CGGCGTTTGGTAGCCATCGTGGTCTCCCCTGTTTTTCTGTCTGTAGAATT
AATTATTTAGTGCACAACCTCGCACTAGGAGAAAAA

Sequences in the Contig:

SY0AAA35YO02FM1 SY0AAA6YI21FM1 SY0AAC28YB13FM1
SY0AAC29YA03FM1 SY0AAC31YC24FM1 SY0AAC38YF17FM1
SY0AAC38YP18FM1 SY0AAC42YM10FM1 SY0AAC44YI19FM1
SY0AAC45YK16FM1 SY0AAC46YP15FM1 SY0AAC48YC04FM1
SY0AAC49YO03FM1 SY0AAC50YL22FM1 SY0AAC56YH01FM1
SY0AAC59YI04FM1 SY0AAC5YF21FM1 SY0AAC60YN12FM1
SY0AAC7YJ08FM1 SY0AAD11YM24FM1 SY0AAD14YG24FM1
SY0AAD17YP11FM1 SY0AAD40YB22FM1 SY0AAD52YJ19FM1
SY0AAD61YE17FM1 SY0AAD6YE21FM1