Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig185
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00008760001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein NCU09122
Accession: ref|XP_958894.2| Score: 540 E_value: 2e-53
KEGG Definition: ubiquitin conjugating enzyme [EC:6.3.2.19]; K10688 ubiquitin-conjugating enzyme E2 W
Accession: mgr:MGG_09913 Score: 539 E_value: 1e-53
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0427 Score: 328 E_value: 2e-31
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 241 E_value: 2e-21
Swissprot: Q8VDW4|UBE2W_MOUSE

Sequence:
>Contig185
TTGGCACAACCACTCTCACAGGTCACGATGTTTCACGCCAAACGCCTCCA
AAAGGAGCTTATCAAGATCCACCAAGGTCTTCCGCCAGGAATCCACCTCG
TCGCGGCGAATGACTTTCAAGAATGGCAGATGGACATCCAAGTTCTAGAC
GAGAACCCACTGTACTACGGAAAGACTTACAGGCTCAAATTCAAATTCAG
TAATAACTACCCTATCGAGGCCCCCGAGGTCATGTTTATTAGAGCTACCG
ACAGAGACATCCCAATGCACCCACACATCTACTCTAATGGCGTAATCTGT
CTGGATCTCCTCAGCAGCGGAAACGGATGGAGCCCCGTCCAGAGCGTTGA
GAGCGTGTGCATGAGTATCCAGAGTATGCTTACTGGGAACACGAAGAACG
AGCGGCCAGACGGTGATGACCAGTTCGTCCTCCGCACAAGCACCTCCCTT
CGTAACATCCGCTTCGTCTACGATGACAATACTGTCTAGCTTTTCTTCTT
TCTTCTTCTTTTTGCTTCCTTTTCTCTTCCCCTTTCTTTCCCCCTCTCCC
TAAACCTACCTACCATGTACTCAAAGGCGTTCCGGAATACTTTAAGCAAT
GGGCCGCGAATCGTACATGATACAGGGAGCGTACCAGGGAAATGGTTTAG
GATCGCAGAGAAAACGGGCGAGTGGGCGCATACCTTTTTTTTCCCCTTTT

Sequences in the Contig:

SY0AAA13YO04FM1 SY0AAA16YL10FM1 SY0AAA32YB11FM1
SY0AAA42YB24FM1 SY0AAB10YA05FM1 SY0AAB27YK13FM1
SY0AAB28YO16FM1 SY0AAC31YO03FM1 SY0AAD36YJ13FM1