Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1849
Length(NT) : 876
Best Gene Model Blast : Link to GSTUMT00008634001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001542246.1| Score: 259 E_value: 9e-21
KEGG Definition: predicted protein
Accession: aor:AO090003000551 Score: 218 E_value: 2e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1849
TTGGGCATAATTATCAATCGACCTTGTCTTTGTCGGCTAGATTCTCGGAT
ACCTAACGAATCCAAGCGCTCGCGTGGGTTTAACCGGTCTGCGGCTGCCG
CTTGTGTTGAGGCCGCTCGTGAGATGATAGCGCTCCTCCCTGATGAACCG
AATCCCGTCGGTCTGATAAGTAGATCCCCTTGGTGGTGTCTCTTACATTA
TTTGGTGTCCGCTGGAACTGTTTTGATTGTGGAGATCGCTATGCGGGCAG
AGCATAACCCCCAACAGGCGGATGGGTTGTTGAAAGATTCAAAGAAGATG
ATTTCGTGGTTAAGGGCCATGGGAACGAATAATCTTGGAGCAGAGAGATC
TTGCACTGTACTTTCGAAATTGCTTATTGTGGCGGCACCTAAGATCGGAG
GTGATACATCAGATGTACAGAGAGACTTTCCTCCTTCGAAGAGAAGAAGC
AAAGATGACGACAACTATTCCAGGGCCCACCGCAAGGCCCCGGAAAACCA
CGCAGGAGGAGCAAGTAGGGAAGGGGAAGGGGAAGGAGACTATAGTCACC
ACCACCATCAGGAACAATCTCACAACGATATGAGAGGCCAAATGGGGAAC
AACCAAGGGCAACCGCTTGGGGATTTCCCGGATATATTTCGTGGTCTACT
TACAGATCCATTTCCATTTGCTGGGATGCCTATTCACACGAACTTCGATA
ACCCGATTGCTATGCAGGAGGCCCCGCCCCATTTCATGCAACAAAACCGC
GACCAGGAGAGCCTCACCCCTAATCAGGACAATTGCCCCGATATGATGCA
GAGCATCCAGACCCCGCACACGAGCATGATGTTTCCTACCCCTGAGCAGT
TACAAAGGCTGTCAGTTTCTGCCAAG

Sequences in the Contig:

SY0AAA6YI09FM1 SY0AAD33YN09FM1