Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1848
Length(NT) : 2001
Best Gene Model Blast : Link to GSTUMT00008730001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein BC1G_01501
Accession: ref|XP_001559942.1| Score: 1244 E_value: 1e-134
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03684 Score: 1243 E_value: 1e-134
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1043 Score: 949 E_value: 1e-103
PFAM Definition: LETM1, LETM1-like protein. Members of this family are inner mitochondrial membrane proteins which play a role in potassium and hydrogen ion exchange. Deletion of LETM1 is thought to be involved in the development of Wolf-Hirschhorn syndrome in humans..
Pfam Number: pfam07766 Score: 908 E_value: 4e-98
Swissprot: O13920|YDWH_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1848
TTGGCACCAAATTACGCAACTCCTCGCTCCTTCTTCTACTCCGCTGTTCG
CTCGTCCTGAATTCTAGCCCTTCCCTACCGAAAGAACTTTTCATCTCTGT
CTCCACCAATTTTATCTTACCATTTTTTTTCCCTTTTCCACAGTACTGCG
TGCTGCCATTCCTTTTCTCTATCAGACCCCCGATAGGCATCTTCACGCCA
TGAGTTCAGCAAGACTAGCCTTCAATTCGGCCAGACAACGCTCGTTTATA
GCGTCATCAGCTCGGCGCACTTGCCTTCGATCGCCACCCGGGTTATGTTC
TCGTAAAGGTCTTCTGCATTCTCAAATTGCCCGATATCAATCAGCTATCA
TCATCCTTGCTTCTCAGAGGCATCTGAGTACCGATACAGCAACAACTGGA
GTCGGCGGTCCTATCATTCCTCCCCCGGGTTTCGACCCCAAAAAAGCCAG
CAAGCCAGTTCCCCGTGAGGCAACTATCGCAAAACCCTCACCGAAACCGG
AAACCGTGGTTGCCCCCGACAATAGTGGTGCCGAAGCCCCCACGTTAGAG
AAGGATCCAAAAACTACACAAACCGAGAACTCGATTGCTATCGCTACGGC
TAACGAGGGTGGCGTTGAGAAGAAAAAGGAGGAAAAGAAAGCTACTATTT
GGCAGAAGGTTAAGCATGGCGTGCAACATTTCTGGGATGGAACAAAGCTA
TTGGGTGCGGAGATAAAGATTTCTTCAAACTTGGCTTTGAAGATGGCTGC
GGGGTATGAGTTGAGTCGTCGTGAACGTCGTCAGCTCGAGCGAACAGTCA
AAGATTTGGGCCGTCTTGTCCCCTTCTCGGTCTTTATTATCGTTCCTGCT
GGTGAACTCTTCCTGCCGGTCGCTCTTAAAGTCTTTCCCAATCTTCTACC
GAGTACCTACGAAGATCAGAAGGCGAAGGATTTGAAGTCTAGCAAGCTCC
GATCCACCAGGCGGGACGTATCCGATTTCCTCCGCAAGACTTTGCGGGAG
AGTGGTATCCCGTTCAGTGCCAAGACCAGGCAGCGGGAGGAATTCACGCA
GTTCTTCAAGAAGATCCGATCAAGCGGCGAACCCCCCAGCCGGGAAGATG
TCATCAAAGTTTGTAAGATCTTCAGGGACGATGTTACTTTGGACAATCTT
TCAAGGCCCCAGTTGGTCGGAATGTGCCGATACATGAATCTCAATACTTT
CGGAACCGATGGTATGTTACGCTATAATATCAGGCACAAAATGCGGCAGA
TTAAGCGGGACGACCGTGCCATCTCCTACGAAGGAGTGGATTCGCTTTCG
GTTCCTGAGCTTCAAACTGCGTGCGCTTCCCGTGGTATCCGCACCCATGG
CGTCAGCCCCGGCCGCCTACGAGATGATCTCAACACCTGGCTCGAACTTA
GATTGAAGCACGGTCTTCCGTCTACGTTGTTGGTATTGTCAAATGCATTT
ATGTATGCCCAGGGCAAGGAGAGCGAGATTGATTCTCAGTTTGACGCGCT
TGTTTCAGTACTCAGCAGCATTCCCGAGGAGCTCTACCACGAGATTGAGC
TCGAGGTCAACACCCTTGAGGGAGCCGCAACTAATAAGCAGAGACTTGAA
GTATTGAGGGAGCAGCAAGAGCTCATTGAGGAAGAGAACGAACAGAGCTC
CGAGTCTGCTTCTGAAGCCTCTAAGAAGGCCTCGAAGGATGATCAAAATA
TTGACGAGAAGGAGGCGTCCATTCTTGATGCCTCCGAGGGCGGGGTCGAA
GCCAAAGGACCCCAAATAGTTACCGAGAAAGTTGCGAGCCCGGAGGGTAA
GGGGAAGAAGGAAACTTAAAGGGCCAGGATGGGGGGATGGGAAAAATATT
CCACACTCTCCGCCCGGTCTGGGCGGTGCTTGCTTTGCCGGGGAGGTTTA
TATTATCTTTTTTTTTTGTTTTGTTTTGCTTTCCTTACCTTACATTACAG
GTTACCATATTAGATCGGAAACAGGGTCAGGGGTTTGTGTTGATAGACTA
C

Sequences in the Contig:

SY0AAA13YO18FM1 SY0AAA35YA21FM1 SY0AAA6YH24FM1
SY0AAB18YD23FM1 SY0AAB26YH17FM1 SY0AAB8YD11FM1
SY0AAC37YC14FM1 SY0AAC40YB14FM1 SY0AAC60YB08FM1
SY0AAD43YE09FM1 SY0AAD45YC01FM1 SY0AAD46YC01FM1
SY0AAD50YE22FM1 SY0AAD61YJ22FM1