Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1847
Length(NT) : 798
Best Gene Model Blast : Link to GSTUMT00009236001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3514 Score: 111 E_value: 3e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1847
TTGGGCCACTCTCAACCACTCTTCGACCGCTCTCAAGTGCCCTTCGGCCA
CAAACAGTAACTACAACCAAACCAGTAACTACAACCAGACCCGGACAAAC
ATCTACACGAGAAGCAAGCACGACTACCCGTGGCGGCACTGTAATCACCA
TAACCCCAACAATCGGTGTTTCAGGGAGCGACGTGGATAGAAGCGGGCCA
ACCGCTCCAACTACCACCGTCGAAACCTCCACAATTACCTCGGCCGTTGT
CTCTGACGGCATAACTAGCTATGTCGAAGTCCCCATTGTCACAACCCGAG
TCTTTGACCCGGAACTCGCCGGGGGTGAACCCACCACTACCCCCAGCAGC
GGCAACAGCGGCAACAGCGGCAACAGCGGCGGCAACAGCGGCCCCAAGAC
AGCAGTCATAGCGGGCGCCTCCATTGGTGGAACAATCCTCCTCGCGGTAA
TCCTGCTCGGGGTCTTCCTCCTTGCGAAGAAGAAGAAGAAGGCGCAGAAG
GAGGCTCCGGATTTCCAGGGGATATTCACTCCCCGACCCGTGCGAGAACC
GACGATTCCGGTGCTGCCGGCACCGCCATCTAGTGGTGCTGGCGGACGTG
GGAGCACTGCATCTCCTGTATCGGAGTTGTCTTCGAGGGGGGTTGTGACG
CCGGTGCCTAGGTATGGGAGTATGTATGTGCCGCCCGACGTACCGGAGTT
GCAGGAGGACGCGGTAGCGAGGGAGGGGAATGGGGCTGCTGAGTATTATC
CAACGAATATACACTACGAACTGCCCAACAGCGAGCAGCAGCAGATGC

Sequences in the Contig:

SY0AAA56YL15FM1 SY0AAA6YH09FM1 SY0AAB38YF17FM1