Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1846
Length(NT) : 682
Best Gene Model Blast : Link to GSTUMT00001376001 E-value : 4e-91
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1846
TTGGCCCATCTCCATCCGACGAAACGAGGAGCTCGGGCTAGCAGTAACCG
ATCCAAAACTTGTCGCATTGGAAGGCTTGGTTTCCGTCTTATTTCCCCCC
TCATACCAAACTTTCACGGAGGCGCACCCTATGGGACCAGCAATGTGTAA
GGCTACAAGGGTATGTCGCTCAATCCGCAATATGCAAAAGTAAGAGGTGG
AACAGAAGCGAAACTAGAGCAAGGTAACGGGTATGATAGCCCAACCGACC
GACGGAGGGTTTTACAATGCGGATAGAGAAAGGAAGTACAAGGGCCTCTA
TACCAGTGGACCCTTCCATCCTTCCAATCCAGCGCCGACTGGGCGTCCAT
TCGGCCCCGGTACCCGAGCAATCAATAGCAGAATTCGGCAGACTAATTAA
GGAACCTAGAAAGTGGATTCGATGGGAGGGCTGGTAGCCGAGTGCAAAGG
GAGGTGGTGGGGGTGGTAAACCATGCTTGGGCATTGTGAAGTGGAGACTT
CTATGGTGAACAGGAAATCATTCTTGGGATTCATTTATTGTTTTTAATAT
AGCTACTTCTATCTTCTCAGGATATGTTTTTTAGAGGATGTGCGAACGGA
GCTAGAAGCGACGACGATTATTATTCTCTCATTTGGACATATCCCTCATT
TAGTTCACACTTGTCTTGAGAACACAAAAGCA

Sequences in the Contig:

SY0AAA22YN24FM1 SY0AAA6YH04FM1