Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1845
Length(NT) : 824
Best Gene Model Blast : Link to GSTUMT00001437001 E-value : 8e-31
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1845
TTGGCTATATCACTCATTAGTCGTTCGGTTATCCCGGGGGTTTTTTTTCC
AAAAATAGTGGAACCGGGATTGTGAAGAATTCGCTGTGAGAGCTCCAAGA
CGCCAAGAGGGCATCCTTTTCCCCCCCAAGTCCAAAAAGGGCCGAGTTGT
TGCAGCAGAGGGAAGAGAGCATCTGTCACCCACAGTTCTTGGAACCTTCC
ACGGAACCTTTGGAGAAGGGCATTGCTTGGTCTTGTTCCCGAGAGACAGA
AAGATTTATTTTCTCCTGTTCACCCTTTTCTTCCTTCCCTCTTCTTCCCT
TTCTCTCTACAAAACTTTATTCTACTTTCGTTCTTGTACTACACGAGTAA
AAGAGTCTCGGTGTGCAATTGTCGGATTGTGAGCTCAGTTTACTTCACTG
TCGTTCGTTCATCGATTCGTTCATTCTCACCGTCACTACTGTTAGCAACC
TGTTTTTCGGTTCGCCTGCTTCTGGGGCCCCAGGAAAACGTTTACCTGCT
TTTTTTAGTCTTTGCAGAGCAAAACAGATCTGGGAACGTCACACCGCCCA
CGCAACGTTGCACCATCATACAAAGGAGAAGGAGAAATAGGAGGGAGGAC
CTAGCCTTTTTGCACTCGTTAACAGTCAACTTATTCCGTTTACCAGAGTT
CGGGACCCCTTCCCCCCGCTTTTCTCTTTGAGGCTCCATCCCTCGTTTTT
TACCTTATAAAACACTATCCTTGGTCCTGCAAAGAACCGTTGCCGAATTA
CCAAGTTATGGACTCTTGCTTCCTCGATAGTCTGGAGCATCTGGCAAAAC
GACAGCACGAATCCAATGATACAC

Sequences in the Contig:

SY0AAA6YG09FM1 SY0AAB46YC02FM1 SY0AAC51YP22FM1