Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1844
Length(NT) : 1471
Best Gene Model Blast : Link to GSTUMT00007137001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0566 Score: 114 E_value: 3e-06
PFAM Definition: DUF605, Vta1 like. Vta1 (VPS20-associated protein 1) is a positive regulator of Vps4. Vps4 is an ATPase that is required in the multivesicular body (MVB) sorting pathway to dissociate the endosomal sorting complex required for transport (ESCRT). Vta1 promotes correct assembly of Vps4 and stimulates its ATPase activity through its conserved Vta1/SBP1/LIP5 region..
Pfam Number: pfam04652 Score: 119 E_value: 7e-07

Sequence:
>Contig1844
TTGGCTTCTCCTCTGCCACAGTAGACGGTGGGCAGAGAGACTTGCCGAAC
GCGAGTAACGAGGTCACTGGAACCATACCTACCCACTCGCCTACTTGCCT
GCTTTAACTACACTACCTTCTCCATCACACCTACCTACCTGCCCTGCCTT
ACCTACTCGAGTACCCACCCTACCCACCCGCTCCTCTGCCCAACCATTAC
CGCCTACCGTACCTGCCTATTATTCACCCTATTTCCATTCCCTCCATCCC
ACCACTTCCTCCACCTTCACCACCTGCTCTTACCCCCCCCCGCCGGATCC
GTGTATGCATCGTCGTCATCATACCCAAACGACAGCTACGAACCTTAATT
TATTCCATTCGACCGCCTATCCCCGCACCAATTGAAGGCAAATGGTCTAC
GTTCCCTGGCGCCTCAGCAGTCTAGAGGCTTGCCACGTTTCAGAGGAGGA
ATGGGCAGGCCTACGCTCGACAGTTATAGAAGCCCTGAACACTAGCACAA
TTGGCCTCGAAGGCCCCTCAGTGCACGGGACCGCGTGGGACGATTGGTTT
GAAGAACTTGCCGAGAGAGTCGCGAGGGAGTACTGGCCCAAGACTGATCG
TGTGGCTGTTCGCAGGATCTTCAGACCGCAGGTTATTGAGATGGCCGGGG
TTGAACGTGGGAAGCGGCGTGCTCAGAGGGCTGGTGGGAGCGAGGATACG
GATGGCGGGGCGGGAAGCAGCCGCGCGAGGCCGAAGAGGGAGGACGAAGA
GGACGAGGAAATGGGGAATGCTCCAAATGTGTCGACTAGCACCGCGACCG
TTCCTAGGGCGGCCACTCTTCCCTCGACCCCTCGCGAAAGCGCAAACGTC
ATACCCTCTCCCTCTTCCGCACCGAATCCCCGTACGGAGGAGGTGGAGGA
CACATCCAGCGCCGCGACCAATACTTTGACACCGTTGGAGGCGCCACGTC
GGGGTCCTGGGCGGCCAAAGAAGCCGCCCGTCAACCCACCAACGGAACCG
TCGGATACCCCCACCATTGTGAGGAAACACCCACCGCAAAACCCCCACGA
GGAGGTCAATCCTACGCCACCGAAACGCCCACGCACCTCACGTGCTCATC
CCCCTCCTCCCTGGATCGCCCCCCGCCCGTTGGAGGTTGAGATAGTTGGG
GGCAAGACTTATGTTGTGGACCTTGAGGATGGGAGGGATTGGCTGGCTGT
ACAGGAGATAGCCCGAACGGCTGGAACCAGTGCCGTTGGGGTTGTCGTCG
AGGTCCAATCTCATTGAATCCTTCTCTAACGAATGCTTTACTTTTTAATG
CTTTTTCCTTCATCTCTTTAGTTTATATGTACATAACCTAGATAATGTGC
TGGCAGGCTCGCTAATTCGAGTGATGGCTTGTGAGGGCCACTGGGGCTGT
GGTTGGCGGTATGATAGTTTTGACGAGAAGAACATGCTTTGAGCCAAGGG
AATGCGGGAAGCTATGATGCA

Sequences in the Contig:

SY0AAA6YG02FM1 SY0AAA9YN22FM1 SY0AAB39YB04FM1
SY0AAB45YJ10FM1