Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1843
Length(NT) : 1830
Best Gene Model Blast : Link to GSTUMT00002433001 E-value : 0.0
Numbers of ESTs : 34

Blast Results:

Nr Definition: UDP-N-acetylglucosamine pyrophosphorylase
Accession: ref|XP_001592750.1| Score: 1675 E_value: 0.0
KEGG Definition: hypothetical protein [EC:2.7.7.23]; K00972 UDP-N-acetylglucosamine pyrophosphorylase
Accession: mgr:MGG_01320 Score: 1667 E_value: 0.0
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG2388 Score: 1184 E_value: 1e-130
PFAM Definition: UDPGP, UTP--glucose-1-phosphate uridylyltransferase. This family consists of UTP--glucose-1-phosphate uridylyltransferases, EC:2.7.7.9. Also known as UDP-glucose pyrophosphorylase (UDPGP) and Glucose-1-phosphate uridylyltransferase. UTP--glucose-1-phosphate uridylyltransferase catalyses the interconversion of MgUTP + glucose-1-phosphate and UDP-glucose + MgPPi. UDP-glucose is an important intermediate in mammalian carbohydrate interconversion involved in various metabolic roles depending on tissue type. In Dictyostelium (slime mold) mutants in this enzyme abort the development cycle. Also within the family is UDP-N-acetylglucosamine or AGX1 and two hypothetical proteins from Borrelia burgdorferi the lyme disease spirochaete..
Pfam Number: pfam01704 Score: 430 E_value: 8e-43
Swissprot: O74933|UAP1_CANAL
Gene Ontology:
GO:0003977 = Molecular function: UDP-N-acetylglucosamine diphosphorylase activity

Sequence:
>Contig1843
TTGGCATGATCTGATCTTCCTATTTCTTTCCTCCCTCCCTCATTTATTCA
TTAAAGGCATTCATCATCTATCCTCCCCATAAAAAGTCCTTTTCTTCTTC
CCTACTCAGGTAAAGTCGATCAAATCCGTCAATAGTTCAGATCATGGCAG
CAACAGTCGGGTTAGGCGTTGGAAATGTTCTCAATAAGCTCTCCCTTGGT
TCAAATGCTACGGAGCCATCCCCGGAAGCTGTCGAAGGTCTAAAGGCAAA
GTTTGAGAGTATCAGCCAGGGCCACGTCTTTACGTTCTACGATGATTTGA
GCACGCCTGAGAAAGCAGCTCTCTTCGAGCAGTTGTCTCGCATGGATACC
CAAAGGATCTCTGTCATAACCAAAGAAGCCCTCTCACCTCCCCCGCCAGC
CGAAGCTCCCAAAGTCGAACCTCTTCCAGAGGATGCCACGGCTTCCATTT
TGGATAGTGCTGCATCCGATATCAATGGCTGGTACGAGAACGGTCTCAAA
TTGATAGGCCAGAATGAGGTGGCGGTTGTCCTTATGGCAGGTGGTCAAGG
AACCAGGTTGGGCTCCAGTGCTCCCAAAGGGTGTTTTGACGTCGGCCTTC
CCTCCAGGAAGTCCCTCTTCCAGCTTCAGGCTGAGAGGATCTATAAAGTG
CAAGAACTCGGGGCGAAGAAAACCGGAAATGCGAAGGCTGTGGTTCCCTG
GTACATCATGACTAGCGGCCCTACAAGGGGACCTACCGAAAATTTCTTCC
AAGAGAATGCCTTTTTTGGTCTGTCAAAGGAAAACGTAACCTTTTTCGAA
CAGGGTGTTCTGCCTTGCATTTCCAACGAGGGAAAGATTATCCTAGAATC
CAAATCCAAGGTTGCAGTCGCTCCCGATGGAAATGGCGGTATCTACCAAG
CCTTAATTGCATCAGGTGTTCTTGCCGACCTGAAAACTCGAGGAATCAAG
CACGTCCATGCCTACTGTGTCGACAATTCCCTCGTCAAGGTTGCCGACCC
TGTATTCATTGGCTTCTCCGCCTCAAAAAATGTGGACCTTGCAACCAAGG
TAGTGCGCAAGCGCAATGCTACCGAGTCGGTCGGCCTCATCATTCTCAAA
AATGGCAGGCCAGATGTCGTCGAATACTCAGAAATTGACAGCAAGACCGC
CGAAGCAAGGGATGAGAAGAACAAGGACATTCTCAAATTCCGTGCTGCCA
ATATTGTCAACCACTACTACTCCACCCGCTTCTTAGAGACCATTCCTGAA
TGGGTCACTGCACTGCCGCATCACATTGCCCGTAAGAAAATTCCCTACTT
CGATACCGACTCAGGAGAGCAGAAGAAGCCTGAAAAGCCGAACGGCATCA
AGCTCGAGCAGTTTGTTTTCGATATCTTCCCTCGTATCCCTCTGGATAAG
TTTGCCTGTTTGGAGGTTGGACGCGAGGATGAATTCTCGCCCCTGAAGAA
CGCTAGGGGCACCGGTGAAGACGACCCGGACACCTCCCGCAGAGACGTCC
TAAACCAGGGTACGAAATGGGCCAAGTCCGCCGGTGCCATTATCGCAAGC
ACGGAGGCAGAGTCCGGTGTTGAAATTTCACCTCTCGTTAGTTATGGCGG
TGAGGGCTTAGAATTCCTGGGAGGCCGGGAGATTAAAGCAGTTGCCACTA
TTGATAAGGGGAAGTAGTGGTTATGAAATGGCATGCGTCTTAGTGTTTCC
ATTAAATGATTTTATATGTTTATATCCAGCCATGCCTGTTGATCATACTG
GAATAGACCAATATTCCGTAAAGACGATTTTTACCTTTCCAGCAAGTCTA
TATTCTATCAAACTAAACGCTCTCACTCCC

Sequences in the Contig:

SY0AAA12YH10FM1 SY0AAA20YJ06FM1 SY0AAA20YJ06RM1
SY0AAA24YH06FM1 SY0AAA24YH06FM2 SY0AAA32YF02RM1
SY0AAA33YL19FM1 SY0AAA35YG20FM1 SY0AAA35YL16FM1
SY0AAA48YP03FM1 SY0AAA6YF15FM1 SY0AAA7YB22FM1
SY0AAB22YA06FM1 SY0AAB45YI20FM1 SY0AAC12YE21FM1
SY0AAC21YD09FM1 SY0AAC21YD09RM1 SY0AAC21YG05FM1
SY0AAC21YG05RM1 SY0AAC31YC12FM1 SY0AAC31YC12RM1
SY0AAC59YI19FM1 SY0AAC5YJ07FM1 SY0AAD22YD02FM1
SY0AAD26YH17FM1 SY0AAD27YD21FM1 SY0AAD41YE20FM1
SY0AAD60YM10FM1 SY0AAD61YM24FM1 SY0AAD63YI10FM1
SY0AAD6YP21FM1 SY0AAD8YB20FM1 SY0AAD8YI23FM1
SY0AAD9YI22FM1