Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1842
Length(NT) : 1060
Best Gene Model Blast : Link to GSTUMT00010016001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_08388
Accession: ref|XP_001590648.1| Score: 1141 E_value: 1e-123
KEGG Definition: hypothetical protein
Accession: fgr:FG02482.1 Score: 1045 E_value: 1e-112
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q1K9C2|ECM17_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1842
TTGGCAAGCAGGTCACCGGCCGTTCTTACAGTGTTTTCGAGTACACCGGA
CCTCGCAATGCCGATGTCGCACTCTTCGTCTTCGGGTCTACAACTGGTTT
ATTCCGCTCTACAATCACGAGGACTGCGGGAGATGATTACTCGAGAGTTG
GTGTGATTACCGCTAGACTCTACCGCCCTTGGTTTGGTACGAAATTGGCC
GAGATCATTCCCAAGAGCATCAGTAAGATTGCCGTTCTCGAACAGATCAA
GAAGAAGACTACCAAGTGGGGCCCTTTGTTCTTGGACCTACTCACTTGTC
TACGCACTGGCCCAGCCCTCAAGGGTGCACCAGTCGTCATTGGACACCAA
CTGGGGTTCATCACTCCCGATACAGCAAGCCAGGCTCTACGTGGAGTTGT
CCAGAATTTGAAGTTTAGGTCGCCTGTGCAGAACCTCTCTGTTGGGTTGG
AAGACGTTCCGACTAATGCTGGGCACAAGATCAGCCAACCGGCTGTTGAG
GCAGCGTATATGAAGATTCTCGACCAATTGTTCGGAAAGCGATTGCATAT
CGCCAATTCCCTCGATAAATCCAATGCCGGCATCTCCCCCACCATTACTG
CAAGCCCTGAATATGGGTATGGCTCCCTGCTAGCACGGATGGAGAGGCGC
CAGGCTTTTATCGAGAAGGTTGAGAAACTGGCGAAATCAAATGACTTCAC
TACTCGCATCCCTGCCGAGTGGCTCTCCAGATGGCTTATCGTTGCAGACG
ACGAGGCAAAAAGTGCCGCACTAGTGCCTGGGATTATCATGCGATTGTCG
GTCGATGGATCCCCCGCCGCGTACGATTTGCTCTCTGACAAGGCCCTTTT
CTACAAGGAGTCACATTGGCTTATTGGATCTGATGCTTGGTCATATGATC
TTGGAAACTCGGGCGTTCACCACGTTATCGCTTCGGGAAAGAATATCAAC
ATGCTTGTTATTGATTCCCAGCCATACTCAGAGCACGCTGTGGCCAATGC
TTCACGAAGAAAGAAAGATGTCGGGCTTTATGCCATGAACTTTGGGAATG
CGTTTGTTGC

Sequences in the Contig:

SY0AAA6YF08FM1 SY0AAC61YI08FM1