Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1841
Length(NT) : 941
Best Gene Model Blast : Link to GSTUMT00004978001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: PREDICTED: similar to PASG
Accession: ref|XP_001604847.1| Score: 252 E_value: 6e-20
KEGG Definition: Os01g0390900
Accession: osa:4325232 Score: 231 E_value: 9e-18
KOG Definition:
Classification: [Defense mechanisms].
Kog Number: KOG1716 Score: 340 E_value: 9e-33
PFAM Definition: DSPc, Dual specificity phosphatase, catalytic domain. Ser/Thr and Tyr protein phosphatases. The enzyme's tertiary fold is highly similar to that of tyrosine-specific phosphatases, except for a "recognition" region..
Pfam Number: pfam00782 Score: 306 E_value: 8e-29
Swissprot: Q9D0T2|DUS12_MOUSE
Gene Ontology:
GO:0008138 = Molecular function: protein tyrosine/serine/threonine phosphatase activity

Sequence:
>Contig1841
TTGGCAAGCCGGTTCTATAAAGTCTGCTCTGTTCTGCTCGGTCTATCGAA
TCCTATAGGACCATCTATCCTTCTATCCATATACGAAGCAATCGACCAAC
CTCGCAATCAGGCCGCGAAGCTATTATCAAGGCTAGCATACCAATCAAAG
CAACAATGTCTATCGAAACCCAGCAACTCCACCGCGCTCTAATCACAAAA
GACCGTACGCTGCCATGCGCCAGATATCGGAGCATGAATGAAATCCTCCC
AACCCTCTACCTTGGCGACTGTAAGGCAATCCTCGACCCAATAACCCTCC
TATCCTCCGGCGTAACGCACGTCCTCTCACTACGGCAGTCGCCCGTGTAC
ATGCGCCACCAAGTGAATGTAAAGCACTGCCAAATCTTCATTGATGATAC
GGAAGACACCTGGCTGCTCGACTCACTCAATGCCGCAATGGATTATATCG
AGCGCGCCATGGAAAGCGGTGGAGTCGTGCTTGTGCACTGCCAGGAGGGG
AGGAGCCGGAGCGCTAGCGTTGTCATTGCTTTTCTTATGAAGCATTTCCG
GGTCTCGTTTGAGGAGGCTTGGGGATATGTACGCCGCCGACGACCGGTCG
CTGGGCCAAACCCGGGATTTGTGGATCAGTTGAAGATCTGGGAGAGGAGG
GGATATTGGTGATTTTCTGAAATCTTCTTTTGTCTTTCCTCCCTTTGCTC
TATTGTTGTCGGGTAATGTTTGAACGAGGACACACTCCTAACGGAAACCT
TTCCTTGTAATTGTTTATTACTGTTTCTCCATTCCATATGATCATCAGCT
GGGGAGTTTCGGTCAAGTTTTTATTTATTTATTTTTTATCTACAGCTTGC
ATGAACGATGGCGCATTCATTACCACCACGGGTTCCTTTGTCGGCCTCGC
TTTTTATTTTATTTTTACCTCTCAAGTTTGCCTGTAGTCTA

Sequences in the Contig:

SY0AAA1YK14FM1 SY0AAA22YB20FM1 SY0AAA2YG16FM1
SY0AAA36YF08FM1 SY0AAA44YG09FM1 SY0AAA48YA11FM1
SY0AAA56YK18FM1 SY0AAA60YP23FM1 SY0AAA62YC20FM1
SY0AAA6YF07FM1 SY0AAB13YJ17FM1 SY0AAB15YJ23FM1
SY0AAB1YB12FM1 SY0AAB30YL23FM1 SY0AAB33YB03FM1
SY0AAB33YL01FM1 SY0AAB34YO23FM1 SY0AAB36YE07FM1
SY0AAB45YO04FM1 SY0AAB50YO05FM1 SY0AAB56YK19FM1
SY0AAB58YD11FM1 SY0AAB60YI12FM1 SY0AAB60YP08FM1