Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1840
Length(NT) : 1329
Best Gene Model Blast : Link to GSTUMT00012030001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: hypothetical protein MGG_00814
Accession: ref|XP_368430.2| Score: 976 E_value: 1e-103
KEGG Definition: hypothetical protein
Accession: mgr:MGG_00814 Score: 976 E_value: 1e-104
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2936 Score: 739 E_value: 9e-79
PFAM Definition: Aha1_N, Activator of Hsp90 ATPase, N-terminal. Members of this family, which are predominantly found in the protein 'Activator of Hsp90 ATPase' adopt a secondary structure consisting of an N-terminal alpha-helix leading into a four-stranded meandering antiparallel beta-sheet, followed by a C-terminal alpha-helix. The two helices are packed together, with the beta-sheet curving around them. They bind to the molecular chaperone HSP82 and stimulate its ATPase activity..
Pfam Number: pfam09229 Score: 430 E_value: 6e-43
Swissprot: Q9P782|YNY8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1840
TTGGCTCTCCACCAAAGTCCACTTCCACTCAGTATCACATCACTCAGGTC
TGCATCCTAAAAACCCCTGTCATTTCGAGTCTCGGTCACTTCCGTTGTCC
CAACTTTTCCCTCACGCCGGAACCACCAGAAGATCCTGTTCCGACCAAAC
AGTTGTCGTACAGGGTTCTTACTGTTCCCGAGAAAGAGCCTGAACTAACT
TTCCCTTACCTTCTAAAGTAGCCGCACTCCTATCCATACCATATCCTTTA
GACCCCCTTAGTGACAAAAATGGTTCTCCACAATCCTAACAATTGGCACT
GGGTCAACAAGAACGCGATCGAATGGGCTCAGGAGTATTTCTCCGAAAAG
CTCACCGGACTTTCTGCGAACAAAGGAGAAGTATCTGCCAAGATTGACAA
AGTTCTGAGCGTTGAGGGTGATTGTGATGTTTCCCAGAGGAAAGGGAAGG
TCATTACCTTATTTGATGTCAAGGTCCGCCTAGAATTCTCCGGAGTCACG
GCCGAAGGTGAAAAGGTTACAGGGAGTATTACGATTCCGGAAGTTGCCCA
TGATACCGAAGAGGGTGAATATGTGTTTGAAATCAATGTCTACTCGGACA
ACAAGGAGAAGCAAGCTGTCCGTGATCTAGTGCGCAACGATATCGTCCCT
CAACTCCGCCAGGCTCTAGCTGGCTTTTCCGGTGATCTTATCGCTGAACA
TGGTAAAGATATCCAACATGCTCCGGGCTCTGGACCTGTTTCTGGCACTT
CTACGCCAAAACCTGCCGCGACCTCATCGACATCTCATGCTGCTTCCTCG
AAAACACAACCAAGCCAGACGGAGACAAGTCCAATAGTCAACACAGTGAC
CTTGAAGGATGATATCGAATTCCAAACTTCGGCTGACCAACTCTACCAAA
CTTTTGTTGACCCTCAGAGAGTAGCCGCATTTACTCGGGCACCACCGTCG
GAATTTGAGCCAAGGGAGGGGGGTAAATTTAGTCTGTTCGGTAGGAACGT
GGAGGGCCAATTCAAACAACTGGATAAAGATAAGAAAATCGTCCAAACAT
GGAGGCTGGCCGACTGGCCAAAAGGTCACTACTCAACCCTCACCCTTGTG
TTCGACCAAAGCACAAATTCCACCGTGTTAAGGCTCAGCTGGGATGGTGT
TCCCGTCGGCCAGGAAGATGTCACCAAGAGAAACTTTGGAGACTATTATG
TCAGGAGCATCAAGACAACATTTGGTTTCGGTGCCGTTCTGTAAAAAGAT
GATGTCTCTAGATTTGAGCTAAGCGATGAAAGTGCGTATACCTCCGTTGA
CAAGATGGATCCGGTTAAGTGGTTTGGAA

Sequences in the Contig:

SY0AAA13YE05FM1 SY0AAA23YA06FM1 SY0AAA28YN17FM1
SY0AAA47YG12FM1 SY0AAA4YH13FM1 SY0AAA52YH14FM1
SY0AAA6YE21FM1 SY0AAB12YF06FM1 SY0AAB24YC23FM1
SY0AAB37YC09FM1 SY0AAB38YF20FM1 SY0AAB56YH13FM1
SY0AAC22YK22FM1 SY0AAD61YN18FM1