Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig184
Length(NT) : 683
Best Gene Model Blast : Link to GSTUMT00003660001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: small GTPase CDC42
Accession: gb|ABD63923.1| Score: 503 E_value: 3e-49
KEGG Definition: hypothetical protein
Accession: ang:An02g14200 Score: 499 E_value: 4e-49
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0393 Score: 479 E_value: 5e-49
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 341 E_value: 4e-33
Swissprot: O94103|CDC42_COLGL
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig184
TTGGGCAAGCCAGCACTTCTTCCCATACATCATCGCCGTGTCATCCCGCC
CTCATCTCCTATCCGATCACATCATTCTCGAACACCAAATTCACGCGATA
AAGCCAAAAGGAAGGCCATCCTTTTTCGACAACTCCTGAGAACAATCACG
ACAACAAGCCCCCTCTTGTCAAAGGTCTATCTATCTGACTCCAGTACGAT
TGCTGCCCCACCACGTGTATCTTTCGCTTCCAGACTCTCCCCCCGCACCC
CCGTCTCTCGATCAAACACCCGTTCCCCATTCCTCCTCAACTCTTCGTTT
CCTGCAAGTCTCACGACTTCTCATATCCGCGATCCGACCACGCCGGGGTT
CGATAAGTCACCAGCCGGTTTGCAAAGTATCGAAAGTCCAAAATGGTCGT
TGCAACTATCAAATGCGTAGTCGTTGGTGACGGAGCTGTTGGGAAGACCT
GTCTTCTTATTTCCTACACTACTAATAAGTTTCCGAGCGAATACGTTCCC
ACCGTGTTTGACAATTATGCTGTCACTGTTATGATTGGAGATGAGCCGTA
CACTCTTGGGTTATTCGATACTGCAGGGCAGGAAGATTACGATCGACTCA
GACCTTTGAGCTATCCTCAGACCGATGTGTTCTTGATTTGTTTCAGCGTC
AATTCCCCTGCCAGTTTTGAGAACGTCAAGGAG

Sequences in the Contig:

SY0AAA16YL08FM1 SY0AAA45YE02FM1 SY0AAA58YL09FM1
SY0AAD51YK18FM1 SY0AAD62YL16FM1