Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1839
Length(NT) : 921
Best Gene Model Blast : Link to GSTUMT00009119001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein AN2777.2
Accession: ref|XP_660381.1| Score: 810 E_value: 1e-84
KEGG Definition: hypothetical protein
Accession: ani:AN2777.2 Score: 810 E_value: 6e-85
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1535 Score: 368 E_value: 5e-36
PFAM Definition: FAA_hydrolase, Fumarylacetoacetate (FAA) hydrolase family. This family consists of fumarylacetoacetate (FAA) hydrolase, or fumarylacetoacetate hydrolase (FAH) and it also includes HHDD isomerase/OPET decarboxylase from E. coli strain W. FAA is the last enzyme in the tyrosine catabolic pathway, it hydrolyses fumarylacetoacetate into fumarate and acetoacetate which then join the citric acid cycle. Mutations in FAA cause type I tyrosinemia in humans this is an inherited disorder mainly affecting the liver leading to liver cirrhosis, hetpatocellular carcinoma, renal tubular damages and neurologic crises amongst other symptoms. The enzymatic defect causes the toxic accumulation of phenylalanine/tyrosine catabolites. The E. coli W enzyme HHDD isomerase/OPET decarboxylase contains two copies of this domain and functions in fourth and fifth steps of the homoprotocatechuate pathway; here it decarboxylates OPET to HHDD and isomerises this to OHED. The final products of this pathway are pyruvic acid and succinic semialdehyde..
Pfam Number: pfam01557 Score: 374 E_value: 1e-36
Swissprot: Q8CPT8|Y665_STAES

Sequence:
>Contig1839
TTGGGATGGTTTGGGATCGAGAAAGATCTATTAAAGGGAAGAACCTCCAG
AGAAAAAAAGAGTCCTGATGGTATCAAAGAAGAGGAAGAACGCTACCGTA
TCGTTCTAGGCTTGCTCCGTCCGCTCACCCGCACCTACCGAGCCAATTAA
ATCATGACAGTCCCAGCCTCAACCCCCCTAACAAACTTCGCAACCTACAT
CCCTCTCAATTCTACACAAACGCGGGTCGGGCATTTGGATCTTGAAAGCC
AGAAAATAACCCCTCTCTCTCATCCATCGGGAACTCCTCTTACAAACCTC
TACGAAGTCATCTCAGCCGGCAAGAATGCTCAATTCGCCCCAACCTCCAG
ATTCGAACCTCCCCTCAAGCTCTCCTCTGTTACTCTTCTCCCACCGATAT
CAGGTAGGGATGTACTAGCTGTAGGAAAAAATTATGCCGAGCACGCAAAA
GAATTCAATTCTAGTGGGTTCGACTCGAGCGACAAGATTGACCAACCAAC
ACACCCAGTCATATTCACCAAACGGGCCACAAGCATTGTGGCATGTGGGA
GTGAGATATTCCCACACGCGGGATGGACAGAAACTTTGGACTATGAAGGA
GAGATTGGGGTAATTCTGGGGAAGGAGGGCTTTGGGATTCCAGAAAGTGA
AGCTTTGGATTATGTTTGGGGATTTACAATCATAAATGATGTAACAGCCC
GAGAAAGGCAGAGGGATCACAAGCAATTCTTTCTTGGAAAGTCTGCAGAC
ACATTTTGTCCCATGGGGCCAGTTGCCGTACCAATAACATCTCTCTCGGA
CTACCAATCCCTGCGAATAACAACGAGCGTAAACAATGAACTTCGTCAAG
ACTCGAACCTCTCGGAACTAATATTCTCCATCCCCACCCTCGTCTCCACC
ATCTCGAGCAGCCAAACCGTT

Sequences in the Contig:

SY0AAA3YP19FM1 SY0AAA61YB04FM1 SY0AAA63YM05FM1
SY0AAA6YD18FM1 SY0AAB28YK13FM1 SY0AAB30YH12FM1
SY0AAB31YG03FM1 SY0AAB41YL21FM1 SY0AAB46YE03FM1
SY0AAB6YD11FM1