Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1838
Length(NT) : 1125
Best Gene Model Blast : Link to GSTUMT00003881001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: Probable kinetochore protein spc25 dbj|BAE56540.1| unnamed protein product
Accession: sp|Q2UPH5|SPC25_ASPOR Score: 289 E_value: 4e-24
KEGG Definition: uncharacterized conserved protein
Accession: aor:AO090005001640 Score: 289 E_value: 2e-24
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG4657 Score: 118 E_value: 6e-07
PFAM Definition: No Hit Found
Swissprot: Q2UPH5|SPC25_ASPOR

Sequence:
>Contig1838
GAATGACTTTTATTGGTTTTATTTTATTTTTAATAGCTCATTGGGCTCAC
GTGTATTGGCTTGGTAGATGTTAGTGGACGCTTATCTGTGGGAGTGACGG
AGTGTGCGAAAACGATGTACCGGAGGCATGGGTGTATGTAGGGAAGAGCG
GAAGGGATGAACGGTGTCGCTGTGCCTGTGTGGGCGGTGCATAATTGAAT
GAGATAAATAAAGCAGAAAAGGCCCATCGTATGGGAAGGACCTTTTCACT
ATACGCTAATGAAATACACCCAGTTCATACGCTGGCCGCCGGGGGTATAT
CCGGTTCACTAAGAGTACGATGATCAATTGCAAACGATGTGGAAAAGTGA
GGAAAAGGGCCTTATACGTAGAGCCATCTGTGAAGGGGAAAGAAAAAGAG
CGAGACAGGAAATGATAGAAGACAGCAAAGAACCAGCCCGGCCCCGCAAT
GCGGCAAGCCTCTCAATTAAACACTCTCCCAATCCCTGGGGATAAAAACA
TGGTCGCAACTGGAATTGGGGGAGGGGGGAAGGAAGAGAACAACAACGAA
GAAAACAATCCCTTGGCAAATTACTCGCCATGTTCACTATCTCCCAAATG
GCGGGGGCGACGCTGGGTTTCTGCCCGTGGACCCCGACAAGTCTCCACTC
CCAGTCTTCCTCAATGCCTGCCTCATTGTCTCGATGGTGAGTCTCATCAG
CCCCCCCCTCATCGCAAACACACGCATTGTCCTCCCCACAAGCAACTAAC
CATAGCATGGCTGCGACGCTCCCCCAAATAAACTTTGGTTTCGAAGAGCT
CAAAGACCGGATGGCAAGGTTCACCGTGCGATTCGACGACTTTATCGAGA
AGGGGCGCCGGAGGATTCTCGAGGAGAAGAATGAGTTTGCGAAGACGATT
GTTGAGGATAAAGATACTCAGAGGATACTAAAGAAGGAGATTGAGCATTA
CAAGCAGAAGGAGAAGGATGTCTCAGAGAATGTGGCAAAGGAGCAACTGG
AAGCCACCGAAGCAGAACACACGATCGCAGAAATGGACCGCAAGAAGCAG
TCCAGGCTGGAGCACAAGGCTCACTTAGTCGCGCAGATTGAAGCTACACA
GGAAGCCATCCGAAAAAAGCGAGAG

Sequences in the Contig:

SY0AAA6YD09FM1 SY0AAB12YC16FM1 SY0AAB39YJ22FM1
SY0AAC59YH16FM1 SY0AAD43YH06FM1