Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1837
Length(NT) : 1169
Best Gene Model Blast : Link to GSTUMT00010556001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1837
TTGGGAGCGAGGGCGAGGAAGAGGAAGAAGAATTTGAGGATGAAGAAGAC
GATGAGGATCTTGGAGCCCAAGGAGGCTATGGCGGCCGTGAGGCTCCCGA
AGAAAATGCAGAGTATCGGGGTAGACATACCGGCGATCCTGGTTCCGCGG
TTGCTGTTGAGGAAAATCACCGGGAGAACCCTATTCCTCCCACTCCTTTC
AAAGCCAGCCAGAGCATGCTCAGCAATGGGGCTCCAACAATTCCCGATAC
CCCTGAACTTGCCCCGATGAGTGATGAAGGCCACTCGCTTGATCCTTCCA
AGACTCGCTGGTCTGGCCTGTTCGGTGAAAACGAAGGTCTCCCTTCTCCT
GCCCCCGACCGCGACAACTTCCCTAGCTTCCAGCAGCCTCTCTTTTCAAG
CGCCGGAAATATGATCCCTTGGGAAGCAGTTGAGGAGCATACCCATGGGA
AGTTTGAGGATTTCCGTAGGACTTTACTCGAGGATCTGAAGGCTCGTCAT
GGAACTTCGCCGAAAACCGCTCAGCAGTTCAACCATGTTCTGCTAGATGT
AGAGAGGATCTTTGGCGGTATGCATCACATAGCGAAGCTTGCGCCAAGGC
TGCCGGACGGTGGGAGCGGGCCTGTTGCTTCCCACACTAGAGACTCATAC
TCGTATGTAGCGCAGCCCGCTGGCCAAAGCGAGGTCCCGCTTAATTATTA
TGCGTCTCGGGAGTTGTTCCAAGGCCCGGCGAATTTCCCGGTTAGAGACG
ACAACCTAGCCCTGCCGTCGCTCACTACCGCTGACACCTTGTCGTTACAC
GACTCGGCACGGCCCGGGGCGGCTCCCCAGGATCTCGTTCTGGATGGCGT
GCCCGCTCTTGGGCCCCGGCCTGCCATGGCTTCTGACCCGGTAGGCTCCG
GTATGCCACAACCCCAAGCTGGACCCAGTACTCGTAGAGTGCGTGACAAC
TTTGGTAATGTCTTGGCTCACTGGAACAACGAGGGTCTCTGGTCTGTTGG
CGGCGATCCATCCGATATGCAGTCCAGCTTTGATTTCGCAAATGCCAATT
GGTGGATGGAAAGCGGTCAAGATGGAGAGGGAGAAGGAGGAGGTTTTTGA
GATTTTCCTTCTTCCATTTTCTCTTGTATCTTTTGACAGGGGGAGTTGGT
TTCCTTTTTCCTTCTTTTT

Sequences in the Contig:

SY0AAA4YJ24FM1 SY0AAA6YD04FM1 SY0AAB28YP14FM1