Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1836
Length(NT) : 555
Best Gene Model Blast : Link to GSTUMT00011623001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_10999
Accession: ref|XP_001587759.1| Score: 223 E_value: 5e-17
KEGG Definition: hypothetical protein
Accession: ani:AN3455.2 Score: 222 E_value: 3e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53254|UTP22_YEAST
Gene Ontology:
GO:0032545 = Cellular component: CURI complex
GO:0005732 = Cellular component: small nucleolar ribonucleoprotein complex
GO:0032040 = Cellular component: small subunit processome
GO:0005515 = Molecular function: protein binding
GO:0006364 = Biological process: rRNA processing

Sequence:
>Contig1836
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGAAAACGAATAAAATTAT
CATAATGGCGCCTGCTACAAAAAAACGCCGAACCGAAATAGAGGAGGGTG
ATGAAGAAGTTAGGGCCAAAGAGACTATCGGTGGGCTCTCTTCGGAAGAA
GAAATGGAGGCTGTTTCTAAGGAGGACGACTTTGGAGACCGAACCTTTGA
GGCGAAATCAAAACCACGAAAGACCCCCAAACACTCTTCTTCCGAGCAGG
AAAAAGCGCAGGCTATTAGCGAGAGCTATGAATCCAAGACCAACGTGTTC
CGAATGGAAACTGAGGAATTGCTCTCTGAAATCCGTGTGGACTATCGCAA
AAGAATGGCACCGGCAGAGAAGATGCTGCACAAGCTTAAGAATATCATCG
AAAAGATCCCACGCAAAACAGGTGCCACTATTGATAAGGTTGAGGGGGAA
ATGCGAAAGTGCAAAATCCATATTCCATTCCCGGAGCCGAGGCCAGGAGC
AGACATCAAGTACAAGTTCTCGTACGAAAGGCCGGCATACATGAATATCG
CGGGA

Sequences in the Contig:

SY0AAA1YI17FM1 SY0AAA6YC23FM1