Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1835
Length(NT) : 878
Best Gene Model Blast : Link to GSTUMT00008071001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein MGG_13438
Accession: ref|XP_001409508.1| Score: 697 E_value: 1e-71
KEGG Definition: hypothetical protein [EC:3.4.13.9]; K01271 X-Pro dipeptidase
Accession: mgr:MGG_13438 Score: 697 E_value: 7e-72
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2737 Score: 405 E_value: 3e-40
PFAM Definition: AMP_N, Aminopeptidase P, N-terminal domain. This domain is structurally very similar to the creatinase N-terminal domain (pfam01321). However, little or no sequence similarity exists between the two families..
Pfam Number: pfam05195 Score: 188 E_value: 4e-15
Swissprot: P43590|YFH6_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig1835
TTGGGGTAGTTTGATCTTCCCTCGCAGCTCATCTCTATCCCTTCTTCACG
CAACAGCAGCGGGGCAAACACCGCAACTTTGACGATACGCAGAAATGACC
TCGGACTCGACTGTTGATAAAATACTGGCCGGGAAATACCCTGCTAAGCA
ACACGCGGAGAACGTTGTAGAGCGTCTTCTCCATGTTCACCCCGACCTTA
CGGACGGGGTCATCTATCTCGAATCTCAGAGGTCAAAACTTTATGAGAAC
TCTGATCAGGAAGTTCCCTTCCGCCAACGCCGTTACTTTTATTACCTCTC
TGGCTGCGACCTCGCAGATTCCTACCTCACCTATTCCATTCGCGATCGGA
AGCTCACGCTCTTCATCCCACCCATCGACCCTGCTTCAGTACTCTGGTCC
GGACTTCCGCTCTCTAACTCGGAGGCACTAGAGAAATACGACGTGGATGA
AGTCCTTCCGACCTCAGCTACGGCCCTACCAACCACATCCTACTCTAGCC
TAATGTTTGTAATCGAGAGCCAAACTTCGCGTACCTTTCACCTCCAAAAC
ACCGAGAGCTTGGAGCCAGCTATCGAGCGCGCGCGCGCAATCAAAGACGA
ATACGAGGTAGCCCTGATCAAGAAAGCGAACCGAATAAGTGCACTCGCAC
ACCACTCCTGCCTTCGCGCAATCAAGTCTGCCGGAAACGAACGCGAGATA
GAAGCAGTCTTCACGAAGGAGTGCATCGCAAACGGTGCGCCAAAGCAGGC
GTATTCCGGAATCTTTGGCAGCGGCAGGTCCGCGAGCACCCTGCACTATG
TGCACAATAACCAACCACTTGCCGGGAAACTGAACTTGCTATTGGACGCT
GGGGCAGAGTACAACAACTACGCTTCAG

Sequences in the Contig:

SY0AAA13YO21FM1 SY0AAA6YA07FM1 SY0AAA6YC18FM1
SY0AAB19YD16FM1 SY0AAB61YN18FM1 SY0AAC17YL13FM1
SY0AAC32YA09FM1 SY0AAC47YN11FM1