Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1834
Length(NT) : 1109
Best Gene Model Blast : Link to GSTUMT00002227001 E-value : 1e-106
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1834
TTGGGTGGGAATTATCTAAACAGTCCAAACTGCTTACACCCTGCAACCAT
GACCAGGGTTCCCTTCAACTACAAGGCCTGAAAAAAACCTAGCCTCAACA
CCAATCAGTCCTTCCCCCCCCACCCTATCCAGTCATGCAGATACGGTCGA
TGGAAAGACACCTACCCACTCTCGCATGAAGAATCAGTCTTCGATTTCCG
GCAAAAAAAGAAAAAAAGAAAAACCAAACAAAGATCTTACGCTGCATACG
GTACTTGTACGGTACAGTACTACGAGTAGTTCTCGAGTACTGTACTCACC
CATTCAGCACCCGCAATCGGAAAAAACGCAGACCCTGGCGGTCAGGCATG
ACACTGCGCTCGAGTAGGTATGATAGGTATGGTAAACAGTTGCAGTACCG
GTATGCTACTACGCGACCTATACCATATCACCACCTACCTAGGTCGCCCG
GGGGGGATCTGATTACGCCGTAGGGCCCGAATGACGGGGTTGACCCGGCC
CTTCTGTAACGGTAGGGGTCTGGACACCGCATCTGGGGATTTGCCCTGAT
ATGGTGGCTTTTGATGCACAGGATAGGCTGATGATGATGATGGTGATGGC
GCTGATGGCTACTCCCGATGAATGAATTCCCTGCGGAGTACTCTTCACCC
CCACCGCTCAAGTCATGATTTTGTCGTGCAGAGCTTAGCTGCGCAATCGC
ATTGTACCTGAGTAAGGGAACTGTGGGGGATGGTCCTCTTTTTTTCCCCT
TCTCACAATCTAGATAAATAACCTCGTCGATGCCCCTCCGCTTCTGACTT
TCACTCCCCACATACGCCCATACATACGTACGTACGTGCGTACTAATCTG
CAACTGAAACGACAAGGGGAAAAAAACTTTACACAGTTTACGTACGAGCA
CATAACCAAATTTACAATGGCGACAGTCTCCCAACCCGCCGTTGCCAATT
CCTCGCTACCGACGCCGTTTCCCCCTCTATCGATATTGGAAGCTTTCATA
CCTAGCTACCTCTCCCCGTTAATCTCTTACTTTGGTCTCGGCAATGCCGT
CACACACATCCTCGCCTTCTTCCTCCTCACCACCTTCACGGCAACGGGTT
GGACATACT

Sequences in the Contig:

SY0AAA6YC11FM1 SY0AAC9YA23FM1 SY0AAD52YJ09FM1