Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1833
Length(NT) : 917
Best Gene Model Blast : Link to GSTUMT00006943001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_02404
Accession: ref|XP_001596188.1| Score: 168 E_value: 3e-10
KEGG Definition: predicted protein
Accession: aor:AO090023000304 Score: 150 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 111 E_value: 4e-06

Sequence:
>Contig1833
TTGGAACATACGAAGCAGAAGGGGAGATAATATCATAATATCATATGATA
TCACAAGATTCCCGAATGAATAACCCCACCGAAGCGCTATGATAACAGGG
TTAATACAGTGATTACGATTACCATAGGTTAACTCGCACCAACCAGAAGA
AGTTGAAGGAAATACTTAACCGCCACACACCCCCGCTGCACAGGGCAGTT
ATCACGCAGGAGCGAAGCAGAGGGACAGACACACAGAGTCCCCGTCCTTC
ACCAACAGAAGGAATGCATTCCGCCAGTGCCCGTCCGTCAACGCCTACTC
CACTACCGGGAGCCAGGCGCACTACGTCGTCACTATCCTCACAACTAGCC
GCCTCACTTCCACCATCTCACCCAGCAATAGCTCCCCCCGCCTCCGCTGC
CCACGCCGACAAGAAGCTCTTGGAGAGCCAAACCAACCGGATGACCAGTA
CGATTGCTGCTTCTGCTGCCGTAACCCCTAGTACAAACAACATCAATAAC
AACAACAGCATCATCAACACCAATTCCTCCTCCCCCTCCTCCTCTTCTTC
TTCAGCAGCGGCGGTGGCAGGAACAGCTTCTGCACCCTTTACTCCTAGAC
GATTAAATTTTCCTGGACGATTATCCCTGCAGATGCCCTCCCGTGGGCCT
TTATCTCCGGTCTTGGACCCTGCGCTTGGTTACTCGGTTGCGAGGAGGCC
TAGGCTTGACTTTGCTCGGGCTTGTACCTCCCTCCACCATTCCACCCTCG
CCGAGCAACCGTCTCCAGACTCCTCACCACTTAACCACACCTGCTTCCCA
ATCCCACGGAACAATAGCAATCACAACAAAGGCTCCGACTCACCCATAGC
AAGCCATCATGGTGGCCATCATTCCTCGTCCCATGCGTCATCGTTGGGGT
CTACCTGCATGCTGGAC

Sequences in the Contig:

SY0AAA6YC03FM1 SY0AAC3YM04FM1 SY0AAD62YM06FM1