Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1832
Length(NT) : 635
Best Gene Model Blast : Link to GSTUMT00011780001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein SS1G_10561
Accession: ref|XP_001588115.1| Score: 188 E_value: 8e-13
KEGG Definition: predicted protein
Accession: aor:AO090672000001 Score: 171 E_value: 4e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1832
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAAGTTCCCAAGTTCCTAA
ACTCAAGTTTGTCACATCTGGCCGTTATCGTGGACTTGTAGCTTTTTTGT
TTTCTTTCTTACTCATACCTGATACTGTCTCGAGTGTCGCAACAATTCTC
CTCTTCTTCCTCTTTACCATCAACAAGCTTCCTCTACTAAACTCACTCCT
CTGCTACTCACCTGCAAAACTTTTTGTAAACTCAAACACATACTTCGTTT
GCAATCATGACCCGCACTCAGAAAGCCAACGATATCCCTCACAACCACCC
CGAGGCTGAAGCAGCCTTCAATGAGCACCAAATCCCCAAGTTCTTTGGCA
AGAGTGGCCATGTCGACACCGCTCCCAACAAGACCAAGAAGAACGGCGGT
GGAAAGGGCAACTGGGGCCTCGCCGGTGATGAATTGCAAGACCTTCCCGA
CGAATACACGGTCTTTAAGGCTCGTCGTCGCTCCAATTCCATGGGCCATA
TCGAGAACATGTACGTCAAGTCCAAGTTTGAAACCCTCGACGACGAACCC
GTTTTCGATGAAAGGATCCACGGAGCTGTGGGGCCCGGAGTCGCTGAGGA
CGGGGCTGAACTAGCCTCCACCGTTTCCAATTCTA

Sequences in the Contig:

SY0AAA6YB19FM1 SY0AAC24YM02FM1 SY0AAC30YG20FM1
SY0AAD12YF14FM1 SY0AAD51YI13FM1 SY0AAD56YD10FM1
SY0AAD60YF17FM1 SY0AAD60YI01FM1