Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1831
Length(NT) : 1541
Best Gene Model Blast : Link to GSTUMT00004639001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001217980.1| Score: 955 E_value: 1e-101
KEGG Definition: hypothetical protein
Accession: ani:AN2251.2 Score: 908 E_value: 5e-96
KOG Definition: No Hit Found
PFAM Definition: UPF0187, Uncharacterised protein family (UPF0187). This family of proteins is functionally uncharacterised..
Pfam Number: pfam05249 Score: 426 E_value: 2e-42
Swissprot: P72926|Y1024_SYNY3
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig1831
TTGGCAATGGTCACGGCCCGAGTATTAATGGTCGTCAGAATGGAGAGCCA
AATGGACATCACGGTAGCCCTTCGGCCGCAACGGAGAAGGTGGCTCCTCC
ACCCCTTCTAGTTTGGAGAGTCCGCATATAGTATCCCATAGGACCATGCC
AGTCCGTCCGGGAGATAAACGTGCAGTAGATTTGGACAATTATTTTTCTG
GACCGTTGGATCCCACAAAACATTCCAAGCTTCCGTATTTCATGCGGTTG
CACGGAAGCATCTTGCCGAGCCTCGTGATGCCCATCCTTTTTGTGGCAGC
TTGGGCAACCACTATCACTGTCATTAGTGAAAGAGTCCACTCGCTTGCTG
TTGATTCTCTCTTGTTGACCGTATTGGGTTTCGTGGTCGGTTTGTCGCTG
TCGTTCAGGTCATCAACGGCATATGAGAGGTATGCTGAGGGGAGAAAATT
CTGGGCCCAAATGACTCTACATTCGAGAAATTTGGCAAGGATCATTTGGA
TCCATACAAGTGAGGGTGAAGGCGAGCAGGGCAAAGATGATGTTCTTGGT
AAAGTCTCGGCTATCAACCTCATACTGGGCTTCTGTCAAGCGGTCAAGCA
CAAGCTTCGCCATGAAATTGAAGCTGATTATGCCGACCTCGAACCGCTCA
TCGACCATCTTGACACGTTCGCGAAACGTGCTCGCTCATCCGATAGATCT
GCAACGGCCCATAATCTAGGTCTCTCCAACCGCTCAAAATTCCAAACCTG
GGGTGAGAATCTCGGCCTCCCATTCTGCGAATCCAACCCTCAAAAGTCCA
TCAAAGTAGCCCGTAAGCAAGGGAAGCACCACGGGAACCTACCCTTGGAG
ATTATGAACTACCTCTCCTCCTACTACGAGCACTGCATCAAGAGCGGCAC
TCTTACGGGTCCCTGCTGGCAATCTCAGGTCTCGACCAGCCTCATGCTGA
TGATGGACGCCTATGGCGGTTGTGAACGCGTCCTTAGCACTCCACTCCCG
CTTGCGTACAATATCGCCATTTCCCAAATCACCTGGCTCTATGTCCTCGT
CCTTCCTTTCCAACTCTGCGCAAAGCTCAGGTGGGCGGCCATTCCCGGAA
CCATTGTTGCAGCATACATCATCCTCGGCATTGCCGCCATCGGGCGAGAA
ATCGAGAACCCGTTCGGCAGAGATGTTAACGATCTGGACCTCGATCGCTA
CTGCACAAGTCTTCAACTCGACCTCAATGTCCTCACCAGCTCCCCACCGC
CAAAGGCCCAGGAATGGCTCAAGGCCCCCGCCAATACCCCGCTGTGGCCG
TACAGCTTGAGCTCGTACGACAGCTGGCGAGCCCGTCAGGAAGGCGAGAT
CCGGAGAGCGCTCGTGCATAGGGTTGACCACCAGAGCGTTGAACTCGCAG
ATCATGAGGATAGCGCCAAAAGGGTGGAGGGGAGGCACGGGGGTGTATAG
ATGGGTGGGGTAAACTTTTCATGACTACATGCATTGGTGTGGCTGATGCG
TTTACGTGGGACGGACGGATGGATGAGCGCGTGGGCGGGGG

Sequences in the Contig:

SY0AAA1YA16FM1 SY0AAA31YH13FM1 SY0AAA6YB18FM1
SY0AAB35YE16FM1