Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1830
Length(NT) : 517
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1830
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCGCAAGAGAGGGATACTTGG
GGAGGGCAAGCGCAAGGCGGACATCAAAGGGTCATATCCGGAGGAACAAA
AAAAAAAAAAAAAAGAGATGGAAATCATACAAAATCAGAAAAAAGGAAAA
AAACAGACCTAAAAAAAAACCTCAACGAAAAGTCTGAAAAAAAAGACGGA
AAAACAATTATAAAAAAACCTTTGTTAACGACCTGTTTATGCGGGAAGAC
CCTTTGTTTTTTCATTTCATCGTTGTTCTTGCCCTATCGCCTTTCCCCCT
TGCATCTCCCTCCCTGTTCTTGGCTTTTCGCCTTCCTTCCGTCCTGTACT
CCTTTCCTTCCCCCTCTTGCCCTTCCCCACGCATAACCTTCCACCCTTTC
CCCTCCTACCCGCCCACTTACGCACCCTCTACCCTCTACCCCTTACCTTT
CCCATTCCCTGATGCTATACCATACCATATACTATACAATCACACTCGAT
ATTCCGTTCTGTTCTAT

Sequences in the Contig:

SY0AAA1YE20FM1 SY0AAA63YP19FM1 SY0AAB8YC23FM1