Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig183
Length(NT) : 642
Best Gene Model Blast : Link to GSTUMT00011692001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_06641
Accession: ref|XP_001242745.1| Score: 269 E_value: 3e-26
KEGG Definition: 50S ribosomal protein L27, putative
Accession: afm:AFUA_5G04030 Score: 250 E_value: 8e-25
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG4600 Score: 223 E_value: 2e-19
PFAM Definition: Ribosomal_L27, Ribosomal L27 protein..
Pfam Number: pfam01016 Score: 177 E_value: 4e-14
Swissprot: Q75ET6|RM02_ASHGO

Sequence:
>Contig183
TTGGGGGGATCCTCCCATCTCTACGAAATATCTATGCAGGCGGCATTGGT
AGCAACAGCGGGATCCTGCAGCAAGCCCGTCACGCAACACACAAAGCCTC
CAAAGCCGCCAACGGCTCCAGTAACACCGCCGGGAAGAGGCTCGGTGCTA
AGAAAACCGCCGGTACTCTCCCACGCTTTCCCCCCTCCCTTCCAATCCCA
GACTAACAAATGCAAAAGGCGAAAGGGTAGTCCCTGGAATGATAATCTAT
CGCCAACGCGGCACCCTCTGGTTCCCGGGAGAAAACGCCGGTATCGGCCG
TGACCACACGATCTTCGCCCAGAGCACCGGCTACGTCCGTTACTACCGCG
ACTCCGGGCCCAAAAAGCGCAAGACCATCGGCGTAGCCCTAACGCCCAAC
CAGCCACTCCCGCGCCCGCCCAACGCTGCACGCACTCGCCGCCTCGGCCT
CGAGCCAGTCCCCCTCGCCGAGAAGGAGGATGTCAGCGTGCCGCAGGGGA
CGCCACTGACGCAGGAGGACTGGGCGAAGGCCGCGCCCGGCAGCTATATT
CCCCGTCCGGAGAACTGGAGGATTGGGAAGGTTATGGGACCAGTCGTTAG
GAAGAAGAGTGTTTTCGAGGGCTTCGAGAGGAGTGCCAAGAG

Sequences in the Contig:

SY0AAA16YL02FM1 SY0AAD40YH19FM1