Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1829
Length(NT) : 1002
Best Gene Model Blast : Link to GSTUMT00005241001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE56173.1| Score: 913 E_value: 2e-96
KEGG Definition: protein required for actin cytoskeleton organization and cell cycle progression
Accession: aor:AO090005001224 Score: 913 E_value: 8e-97
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Cytoskeleton].
Kog Number: KOG2229 Score: 845 E_value: 3e-91
PFAM Definition: SDA1, SDA1. This family consists of several SDA1 protein homologues. SDA1 is a Saccharomyces cerevisiae protein which is involved in the control of the actin cytoskeleton. The protein is essential for cell viability and is localised in the nucleus..
Pfam Number: pfam05285 Score: 284 E_value: 3e-26
Swissprot: Q10342|SDA1_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0005515 = Molecular function: protein binding
GO:0042254 = Biological process: ribosome biogenesis and assembly

Sequence:
>Contig1829
TTGGAGATCATGAAGGAAGCGAGTCTCTGCGCCAATTCGAAGGTTATGGG
CGGTGGGATTCGTTTCTTTCTGGGTGTGGATCAGGAGATGGATGAGCAGG
AGGATAGTGATGACGAAGGGGTAGATATTGGAAGGGCGAAGCATCAGGTC
GGGATCAACAAGAAGACGAATAAGAAGAAAAGGCAATTAGAGAAGGCGTA
CGCTCTACTGAAGAAGAAAGAGAAGAACAGGAATAAGCCGCATCCGCTGG
ACTTTTCCGCTCTACATTTACTCCATGACCCCCAGGGTTTCGCGGAGGCT
CTGTTCTCAAAACATCTTTCTCGTAACAATAAACTCACGATGGAACAGAA
GCTGCTTGTCCTCCAGTTGACATCCCGCTTGGTTGGTTTACATAAGCTCA
GTGTGTTGGGGTTATACTCCTATCTACTAAAGTTTCTTACCCCCCGTCAG
CGGGATGTTACACAATTTCTTGTCTGTTGTGCCCAAGCTTCTCACGACCT
TGTTCCGCCAGATGTATTGGAACCCATAGTCAAGAAGATCGCAGACGAGT
TCGTCTCGGAGGGTGTTGCGGCTGAGGTTGCTACAGCAGGCCTTAACGGA
ATTCGTGAGATCTGTGCACGAGCTCCGCTGGCTATGAATGCCACACTTCT
CCAGGATCTTACGGAGTACAAGGGCTCTAAAGACAAGGGTGTCATGATGG
CAGCGCGAGGTCTGATCGGATTATATAGAGAAGTCGCACCTGAAATGTTA
AAGAAAAAAGACAGAGGCAAGGCAGCAACCATGGATATGAAGAACAGGGA
GGATCTACGCTTCGGAATAGAAAAGGAGGGAGTAATCGAAGGCTTGGACC
TCCTGGAACAATGGAAAGCGGAGCAAAAACGACTCAAAATGGCAGCAAAA
GTGGAGATCGAAGTCAAAGAGGCTAACGAAGAAGGGGGTCATGAGGAAGA
ATGGGAAGGCGAGGGTGACGACGATTCAGAGGATGATGACGACACAAACC
GG

Sequences in the Contig:

SY0AAA63YN24FM1 SY0AAB26YD20FM1 SY0AAC28YN02FM1