Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1828
Length(NT) : 1961
Best Gene Model Blast : Link to GSTUMT00009078001 E-value : 0.0
Numbers of ESTs : 14

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE65474.1| Score: 1475 E_value: 1e-161
KEGG Definition: predicted ATPase; K06916
Accession: aor:AO090206000115 Score: 1475 E_value: 1e-161
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2383 Score: 1120 E_value: 1e-123
PFAM Definition: AFG1_ATPase, AFG1-like ATPase. This family of proteins contains a P-loop motif and are predicted to be ATPases..
Pfam Number: pfam03969 Score: 673 E_value: 6e-71
Swissprot: P32317|AFG1_YEAST
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0006515 = Biological process: misfolded or incompletely synthesized protein catabolic process
GO:0006979 = Biological process: response to oxidative stress

Sequence:
>Contig1828
TTGGATGGGTGGGAAATTCTGGCTGGAATGGGTATGATAGGACCCTTTCT
AAGTTGGAAGGGGTATGTATGCAGTAAGAAAAAATTTTCCTTCTTTTCTC
TTCTTTTCTTTCGCATAACCGGCTTAGTCCTTTCCCTTCCACTACACCCC
CGCAAGGTCTTTTTTTATCATACTTTCACTTTTTCCTTTCCCACGAGGTC
TATCACTTACTCGAGTACAAACGTACCGTATCGCGGAAGCTACTGCCCTG
TTCCTTATCCTGTCTGGCCGGTTCCGCGACCTTATCCAGAGCACGTGAGG
CGCACAAACGGCAAGAAGAGGAAGAAGAAGAAGGATGTTAGCGATCCGCC
AAATATTGCGATCACGGCGGCTCGCGCCACCATCACAGCTAATGCGAAGG
AGGAGAAATTTCCACAATACGCCTTCCCCATGTGTTCGGCCCAGTTGGAG
CAGTCTTGGGCCACTGGTTGCCGAGCAGGAGTTGGAGTCTATGCCGCCTA
TGGGCTTTGGCGGTGCGGGGGGTTGTTTGGAGGGGGCTTTGGAGAGGGCG
AAAAAGGGTGTCGCGGCAGAATATAGAATAGGTCCTTTGGATCAGTATGA
GATGCTGGTCAGCGAGGGTCGATTGAAGGATGATCAATATCAGAGAGGCA
TTGTGCGAGAGCTTCACGAGCTTCATCAGAAACTCAAAGAGTACAAACCG
CCAAGTGTCGTACATCCCACCCTCGGATCGCTGGCCCTGCCTCCAAAGAT
GTCACTTCTCAGCGCACTCCTCAGATATACATCCCCAACTCCGGTATCGA
CACAAATCCCGGAGGATCTGCCCCGAGGGCTATACCTCTATGGCGACGTT
GGATCGGGCAAGACCATGTTGATGGACATGTTCTATAACACGCTCCCACC
GAGCATAACGTCTAAAACCCGAATTCACTTCCACCACTTCATGCAAGATG
TGCACAAACGACTGCACAAATTGAAGCTCCAGCACGGCCCGGATTTCGAC
GCGATACCCTTCGTCGGGGCGGATATAGCCGAGTCCGGATCGGTGCTGTG
CTTCGACGAGTTCCAGTGTACGGACGTCGTGGACGCAATGATTCTGAGAA
GATTGTTGGAGTTCCTGATGAGCCATGGCGTAGTCATGGTTGCGACGAGT
AATCGACATCCAGACGATCTGTATAAAAACGGTATCCAAAGGCAGTCCTT
TATCCCTTGCATAACGCTGTTGAAGACAAAACTCACAGTCATAAACCTGG
ATTCCCCCACTGACTACCGGAAGGTGCCCCGGCCCGCCAGTGGCGTCTAC
CATCAAGGCCTCGGCCCTGATGCGCTGACCCACGCGAATAAATGGTTTAG
CTATCTCGGTGATTCCAAAGACATCCCTCGCCCCGCCACTCACAGGATTT
GGGGAAGAGAAGTGAACGTCCCCTTAGCGAGTGGCAAGGCGGCTCGGTTC
AGGTTTGATGACCTCTGCGGGAAACCCATGTCCGCTGCCGATTACCTTGA
GCTATGTAGGCATTATGAGGCGTTTGTTGTCACAGATGTTCCAGGGATGG
ATCATAAGAGCAGAGACCTCGCAAGGAGGTTCATCACATTTGTAGACGCA
GCTTATGAGAGTAAGGCTAAACTGGTCTTGACCACTGCTGTTCCGCTATC
TCAACTATTCGTCTCGGCCGCCGAGATAGGTGCCGCGAGGGAGGAAGTCG
AGGGTCATGATCTGGACGCGAGCATGAGAAGTCTCATGGACGACTTGGGA
CTTGACATGAAGATGTTGAAGAATAGTAGTATTTTCTCCGGAGACGAGGA
GAGGTTCGCTTTTGCGAGGGCCCTTAGCAGGCTAAGTGAGATGGGAAGCG
TGCAGTGGGTTGAGCGGTAGTAATAGTTTTTTTTTCCCTTCAGTCCTTTT
CTTTTTTCACGTTAGATTAGAGGGGGAATAAATTTATAAGATATGTTAAG
TAGATTCCCTT

Sequences in the Contig:

SY0AAA36YI02FM1 SY0AAA63YN03FM1 SY0AAB24YJ05FM1
SY0AAB35YB23FM1 SY0AAB44YH02FM1 SY0AAB53YB16FM1
SY0AAC15YP09FM1 SY0AAC22YA17FM1 SY0AAC26YM12FM1
SY0AAC27YD09FM1 SY0AAC38YI21FM1 SY0AAC40YB10FM1
SY0AAD45YA22FM1 SY0AAD63YP01FM1