Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1827
Length(NT) : 1262
Best Gene Model Blast : Link to GSTUMT00010562001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1827
TTGGCTTCCTCATCCATATTCATTTTTATCTCACCTCTTGACGCTCAAAA
CTTAGCAACACTGCTCAGAGAGTCCAGCCAGTAGTTCATTACCGTCAAGG
CAACCCCGAGATCGCTTTACAATGACTCCACCTTCACTTGGAACAGATGG
GACGGCCCCGACCAACGGAATTTTGAACAGAGCTGTCAATTGCGGCAACT
ATCCGGCAAGGACGAACGGCAACACGGTCACGGTAACCGGATATTCTACA
GGTACATGTCAGCCTGGCAGTTGCAACAAGTTACAATGTTATCGGAATGG
CTGTGGTGGCTCATTCACGGATAGCAGGTCTTGGAGGGAACATAAAAAGA
CCTGTATACCTGTGGGAAGCTATGGTTATCGCTGCGTGTTCCCGGATTGC
CCCGACCGTTTTATGACTTCTAGCCTTTACGACATGATAAGCCACCAACT
GGTTCATCAGATGTTCGCTTGCTGCGCACGGGGGTGTGCCTGGGCCTTCT
CTACACAGGAGGGAGCTATCAATCATGTCATCAAAGAACATCGCATGACC
AAACCTCCTACAGACATGATAAAACACTCGTGGACAGTCCGGAAACATCA
GGGCGAATTTCAGCGACAGTCAAGCCTTTGTTTCGACATCACGGACATCG
TATTGGACTGGGAGGCGGGGGTTTCGAGTCCTCCAGAGGGTATCAGACCA
GCCCCGAAGCTGGCCACATACCCTCTGCCCGGGAGTAGGCATCTCGAGAG
TGGAGCAAATGGTGAAGATACAGAGGGTGCACAGAGTTTGAGCTCGGCAG
TGTTCGCGCACATCATGCATCAACTTGGGGCCATCGGAGATCTATTGGAT
AACCGAGCGTTGGCGCCGACTGCAACGGAGCGCCGCCAAGTGTCTCAAGC
ACTGGATATTATCCAACAAAATCTCCGAAGCAAATCCTTTGCGCGTCCGT
CGGCTAGCTGGAACGGGGGCCCTCCATTCCCCGGCAGGGTTTCGAATATG
TATGGCTTGCACCGTCCGGAGACAGTGCTCCAGGAGGAACCTGCAACCGT
TGGTGCCACAACTACTCTGGAAATCCGCGAAGGGTCCAGACGTCAAAAGA
AGAAAACCGCTACCACACAAATACCTACAGCAATATCGCCCGTACAAGAG
GAAGGTGATGGTGGAGATCTATCCGGAACTGACCTCGACTCCGACGAGGA
GCCCGACGCGCTAACGCTAGGAGCCGACGGCGAACCTCTACAACACACCC
ACCTCTCTGGCG

Sequences in the Contig:

SY0AAA43YF08FM1 SY0AAA63YM17FM1 SY0AAB30YM11FM1
SY0AAB42YO16FM1 SY0AAB58YH04FM1 SY0AAB58YP19FM1
SY0AAB6YI10FM1 SY0AAC49YH16FM1 SY0AAC55YC17FM3
SY0AAD21YC11FM1