Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1824
Length(NT) : 528
Best Gene Model Blast : Link to GSTUMT00006321001 E-value : 1e-105
Numbers of ESTs : 4

Blast Results:

Nr Definition: pyruvate decarboxylase (predicted)
Accession: ref|NP_594083.1| Score: 145 E_value: 6e-12
KEGG Definition: hypothetical protein
Accession: ncr:NCU02397.1 Score: 163 E_value: 2e-12
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG1184 Score: 133 E_value: 4e-09
PFAM Definition: No Hit Found
Swissprot: O42873|PDC4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1824
TTGGATCATAGGTGACCGTAGTGTTTGTTATCTTCCTATTTGTTCTTCTG
TCGCTGATGCCATTCCCATGCACTAAGTTACTGTGCGAGTACACAATCTT
CCTTCCTTCTCCTCTCCTCTTGTCTTCCTCCGCCTTCTTTTCTCCATTAT
TATTACCCACTCCCACTTCCCTCATTCAAACTTGCCGTAACCCGGCCAAT
CTTAATAAGTGCCCTTGGAGCATCCTGCCACGGCATGAATATTTCCACCA
ACTATAGATACTCATTAGCACCCCCTCATCCTCTCATCCGCTCATCCCGA
GCACTGCCACCGGCGAGAACATACCTGGATATAAGGAGCACTAGAGAACT
TCTCGTCCTTGAACAGATTCTCGAGCTCAGTCTTCGACTTGCACAGGTAG
GACATTGCATCTGAGGGGTCTGCACCAAAGAGGCTGAGTAGGTCGGTGTG
GTTCCAGGGTTGGATATCGTTATAAATTGCTTTCATTCCGTGGATCATGC
GTTCGATTGTGTATCTATGTTTTTGTTA

Sequences in the Contig:

SY0AAA63YL18FM1 SY0AAC20YI20RM1 SY0AAC22YP10RM1
SY0AAC26YE24RM1