Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1823
Length(NT) : 958
Best Gene Model Blast : Link to GSTUMT00003193001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU07394
Accession: ref|XP_958478.1| Score: 165 E_value: 8e-10
KEGG Definition: hypothetical protein
Accession: ncr:NCU07394.1 Score: 165 E_value: 4e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1823
TTGGCGTGATCTGAGAAAGGGTTGTTTGCATCGCAGAGCCCCATCGTTTT
CAACCCCCCCTCGTTGTGCCGCTCGCATCCAAGACCAAAGTGAAACCATA
GGAACTCAACCTAACAGATGAACTAAAGAAACGGCCGCTAAAGGTTAGGT
TTCCCGCACCCCTCCACCATAGTCTATAATACTCGTACGGACAAATTACG
GTAACGCCGCCACAATATCCACATACCATCCCCACCACCACCACTACCAC
CACCACAATGCCAATCTTGCCCCAAATCACCCCATCAGATAAATATCTCT
ATCTCTCAGCTGGTATGATACTTCCCCCCATTTTTCCCCTTTGCCCCTTT
ATCAACCGGCTGACCACAGTTTTTTCAAAAAAAAAAAAATCAAAGGCCTA
CTGGCAATATACGCCATTTACACTACTCACTCCCAACTCAACAAGTTCCG
TTCAAGATGTGTTTCGAAACCGAAGGTGGTACCGCCGGATGCGGGAGTTG
ATCAGACGACCGAGGATGCAATCAAGCTAGAAACCTTGGAAACCCTAGCC
CGTGGGATTAACGTCGATATTCGGAACGCCGCCCTGAAAATCATAACCGA
CCGTGCGACAACCGACGAAAACATTGTCCACCTCCTCTCGCAAGTCCGTT
CCTCCACGCCCTCGCAGCGCCTACGCTCTCTCCGTGCGCTGCGCTGCTGC
ACCTACAGCACAACGCTGCAGAAGCTCTGTCAGAAGCTTACCTTCAGCGC
CCTCGTCAGCTGCCTCAACAGCACCCTGCCCACAGACGAGAACCCCACCG
GCGACCCGTTTAGCGAGAAGGAGGCGCTCTACATACTCGCGAGATTGATG
GGGCTCTACTTTGTCGGCAGGGAGATGCTGGTCGATGCGGGGTTTGTGCT
CTGGTTGGCTAGGGCTAAGGTTCCCGGATACGCGAATGTGGTCGAGGCCG
TGTTTGAT

Sequences in the Contig:

SY0AAA63YL12FM1 SY0AAD18YJ01FM1 SY0AAD9YK18FM1