Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1822
Length(NT) : 1165
Best Gene Model Blast : Link to GSTUMT00002678001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: large (alpha-) subunit of general transcription factor TFIIE
Accession: gb|AAL55662.1|AF237419_1 Score: 640 E_value: 9e-65
KEGG Definition: transcription initiation factor TFIIE (alpha subunit); K03136 transcription initiation factor TFIIE alpha subunit
Accession: spo:SPAC458.07 Score: 615 E_value: 4e-62
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2593 Score: 536 E_value: 3e-55
PFAM Definition: TFIIE_alpha, TFIIE alpha subunit. The general transcription factor TFIIE has an essential role in eukaryotic transcription initiation together with RNA polymerase II and other general factors. Human TFIIE consists of two subunits TFIIE-alpha and TFIIE-beta, and joins the preinitiation complex after RNA polymerase II and TFIIF. This family consists of the conserved amino terminal region of eukaryotic TFIIE-alpha and proteins from archaebacteria that are presumed to be TFIIE-alpha subunits too..
Pfam Number: pfam02002 Score: 336 E_value: 4e-32
Swissprot: Q9P3W1|T2EA_SCHPO
Gene Ontology:
GO:0005673 = Cellular component: transcription factor TFIIE complex
GO:0016251 = Molecular function: general RNA polymerase II transcription factor activity
GO:0005515 = Molecular function: protein binding
GO:0051290 = Biological process: protein heterotetramerization
GO:0006367 = Biological process: transcription initiation from RNA polymerase II promoter

Sequence:
>Contig1822
TTGGCCACGATACGCAGGATGGAAATCGCAAAGTCCCTCGTAAAGTGTGT
AGCTCGTGCCTTTTACGATACAAAGCATATTCTTGTCCTCGATGCCCTCA
TGATCCATAACGCTGTTCGCGATGATGAGCTGGGGAAATTGTTGGGCTTT
CAATCTAAGGACTTACAAAAATTATGCGGGAGGCTGAAGGAAGATCGCAT
GCTCGCTGTGCATAATCGGCCAGAACAGAAGGAAGGGCAACAGCGACCGA
CAAACCGGACTTACTACTACGTTGAGTTCAGGAGCACAATCGACGCTGTC
AAGTATCGCATGCACGGCGTTGTCAAGGACGTGGAGAAGAAGATGAATAA
GGACGCTGACACAAAAGGATATGTATGTCCATACTGCCAGAAGAGGTTCT
CAATCCTGGATGCGATGTCGGTGGCTCGCGATGAGATGGGGCTGTTTGTT
TGCGATCGGTGTAATACTACACTTGTGGATGACGATGATAGCGCCGAGGT
CAAAACAAGTCAGGAGCGGTTGGGGAGACTAATGGAGCAGATGAAGAAGA
TTATTGATATGCTAAAGATGATTGACGAGATCGTTGTGCCGGTTAATGAT
TTCGAGACCGCCATTGCGAATTCTGTTCCTGTGCCTCGAGATAAGAATCA
CCTCTACTCAGTCCCCGTCGCTGGGAAAGGCGCCACGAGCACCCGAAGCT
CCGGAGCCCCTGCTTCCATCGAAGTTTCTTTCACTTCCACCTCGGAGAAG
ACAGCTGCTGAGCTTGCCTCAGAGCAGGCGATGAAGCAAGCCCAGGCTGA
GAAGAACGCACTTCCGGTCTGGCACACCAAGTCTACCGTTGACCCCGGCG
CTACGACCACCGCTGGGGCCAAGGAGGCTGCGGAAAGGGAAGCTCGTGCC
CTCGATGGTATTGGAATTGCGCAAAAGTCCAAGGAGGAGGAAGGCAAGAA
AGCTGCTGCCAGTAACGGGGCGAATGGCATTCAGGCAGACGGTAAGGTGA
TACGCTGCCCCCTCTGACATGTTTACTAAACCGGTGGTGCATTAGCTATC
GCTGAATATTATGCCGCATTGGCAGCCCAGAAGGCCAAGGAAGCCCAGGA
GGAGCAAGAAGATGATGATGACGACGAAGAGGAAGAAGACGGTGAGGAGG
GGGCGCGGGGGCCAA

Sequences in the Contig:

SY0AAA4YJ04FM1 SY0AAA60YK16FM1 SY0AAA63YL11FM1
SY0AAD3YC22FM1