Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1821
Length(NT) : 943
Best Gene Model Blast : Link to GSTUMT00002456001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: jumonji family transcription factor, putative
Accession: ref|XP_001264528.1| Score: 833 E_value: 3e-87
KEGG Definition: jumonji family transcription factor, putative
Accession: afm:AFUA_1G12332 Score: 824 E_value: 2e-86
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0958 Score: 443 E_value: 1e-44
PFAM Definition: JmjC, JmjC domain. The JmjC domain belongs to the Cupin superfamily. JmjC-domain proteins may be protein hydroxylases that catalyse a novel histone modification..
Pfam Number: pfam02373 Score: 196 E_value: 5e-16
Swissprot: P39956|RPH1_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0051864 = Molecular function: histone demethylase activity (H3-K36 specific)
GO:0032453 = Molecular function: histone demethylase activity (H3-K4 specific)
GO:0032454 = Molecular function: histone demethylase activity (H3-K9 specific)
GO:0016566 = Molecular function: specific transcriptional repressor activity
GO:0006281 = Biological process: DNA repair
GO:0016577 = Biological process: histone demethylation
GO:0000122 = Biological process: negative regulation of transcription from RNA polymerase II promoter

Sequence:
>Contig1821
TTGGGGATCAAAAACCCTATCATCCAGCATATGGCCGGTGTAGCGGGGGA
GTATAGACAGGAGAACATCGAGAAGCAGCGGACTTACAATCTTCCTCAAT
GGCGCCAACTCTGCGAAAGCAGCGAACATCAACCGCCCGCGAAGCGTGGA
GAAAGGAGGAAGGGCCAAGCTATCAAAGAGGCTCCCGTTGGGAGGAAAAC
TAAATCTAGGAAGAGCGCTGCGGCTGCCGTTCGTGAGGTCAAGGAAGAGG
TCCTTATCGCGCTCGGTGACTTGGAGGATAATGCACCAGTCGCGGGTTCA
AAGAAGAGAAATCCACCGACTCCTAGGTCGCCGGAAAAGGCGAAGCAGGA
GGAGCTTAGTACACCAGGACCAATCACCGATTCCCATGGTCGTCAACCCC
GTATGGGTGGTACAGTCGAATCAACTCCCGATCCCATCACTGATTCTCAT
GGACGCCAACCTCGCCAAAAAAAGAAATATGTCAGGAAAACCGCGAAGGA
GAGAGAGGCAGAACAAGCGATTGCAGATGACGAAGCCTTTGATGGATTTG
ACTTCCGTATCCACAATGCAGATGACTATACTCCGGAGAGGTGTGATGAG
TTGGAGAAGGCCTATTGGCGTACATTAACGTACAGTAACCCACTGTATGG
GGCTGATATGCCTGGGAGCTTGTTTGACGACTCCATCACGAGCTGGAACG
TAGCCAAGCTCGAGAACTTGCTTGATTGTTTGGGCAAGAAACTCCCGGGC
GTCAACACTGCTTACCTTTATCTTGGGATGTGGAGAAGTACATTTGCTTG
GCATTTGGAAGATGTGGATCTCTACAGCATCAATTACATACACTTCGGAG
CGCCCAAGCAATGGTACTCCATCTCAAGAGAGGATAAGCCCAAGTTTGAG
CAAGTGATGAGAGGCATCTGGCCTAACGACTCAAAGAAATGTT

Sequences in the Contig:

SY0AAA63YK08FM1 SY0AAC23YD13FM1 SY0AAC30YG13FM1