Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1820
Length(NT) : 844
Best Gene Model Blast : Link to GSTUMT00001425001 E-value : 5e-66
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1820
TTGGACCTAACCTTTTACTTCTTCTTCTCTTCCCCCTTCTTTCCTTGTAC
TGTACTGTATTTCATAGATAACTCTCACACACTTTCACTCTCGTTTTTTC
CATATTTCAATTTGAACCTTTTTCCTTGTGCTCTCTCTCTCTCTGCTTAC
TACTTACTTTTTTACCACGGTAGCTGCTACCACCACTGTACCACTTACCG
GTACTACTACTACTACATCCTTTTCCCTCTGAGTTAGCGCCCTTTCCATC
CAACTTTCCTTCCCTCTGGTCCTTCGTTTCGTCTTGTTTATTTGGTTTTT
TTCATTTCATTTTTTTCATTTTTTTCATTTTATTTTTTCCTCTTTTCACC
TTTTCCTCGCTGTTTTACTGATTCGAGTCTTTTCCCCTGCCTATTCCCTT
TCTAACACTTTTCTCTTCCTATCTATCTATTCCCCATTTTACCGGATTGT
CATTTCCATCTCCTTCCATATATATTGTTTCGACTGTTCGCAAGGCCCAC
TGACACTTCTGCTCCCACGCTTGCTGCTGCTGCTGCTGCTGCTGTCATCC
ATTCACAGCACCGCTGTGTGTGCCGCTGTGTGTGCTGGGTTTGCATTGGC
TGATTTGAGGCTCTTTCTCCATTGTCGCGATTGCTTTTCGTTCACTCCGC
TCCGCTCTCTTCTGATCTATCTCACTCTTGATTGATGATGCCAGCCGTTT
CCCTGCCTCGCTCCTGCCTTGGTTAGTCTAACCAACGCGCTGTATCTTTT
CCACTCTACGACAACAACTAAACTACTACTGCTACTGTTCACTACTGCCG
CACAACTACCACCACTGCTACTACAGTACTGAATTCTCCTCCAT

Sequences in the Contig:

SY0AAA1YP15FM1 SY0AAA63YK03FM1 SY0AAB45YN12FM1
SY0AAC62YC07FM1