Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig182
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00002247001 E-value : 1e-131
Numbers of ESTs : 3

Blast Results:

Nr Definition: zinc knuckle domain protein
Accession: ref|XP_001269400.1| Score: 188 E_value: 8e-22
KEGG Definition: hypothetical protein
Accession: ang:An07g10270 Score: 190 E_value: 5e-22
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4400 Score: 146 E_value: 2e-10
PFAM Definition: No Hit Found
Swissprot: P36627|BYR3_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0032005 = Biological process: signal transduction during conjugation with cellular fusion

Sequence:
>Contig182
TTGGCCTCACTACCTTCAAAACTTCAACAACTCCTTTCCATCCTTTCTCC
AACACCCCCCGAAGATCCTTCGGACGCTCAGTTTGACAATTGCTACCGAA
TATTCCGACCAACAAACATTTTTACTAATCTTCACCATCCACAGCCAAAA
TGGATTTCGGTTCCGGAAATAATGCTAGAGCCTGTTACAATTGCGGCGAG
GGAGGTCACCAGGTGAACTGCTTTTCTGATGTTCCAACTGCAGACCGAGA
TTACTGATGATGAATTCCCAAGGCCCGTGAGTGCCCAAAACGTGGAACTC
CTGTTTGCTATAACTGTGGGCGTATGTTCTTTCCACGTCCAAATAAGTTA
GGTTTCGAATTGGAGGAGACCATGCTAACAATTCATCTCGCGCAATCCAG
AAGATGGCCACATGAGTCGTGACTGCACAGGCCCAGCCAAGGAGAAATCT
TGCTACCGTTGTGGCCAAACCGGTCATTTGTCTCGTGATTGCAACGATGC
CCCCCAACAAGTTGGTTCCTTCGGTGGTGGTAGCTACGGCAGCGGCGGTG
GTGCCGAATGCTACAAGTGTGGCAAGGTAGGACATATCGCCCGTCAGTGT
ACTGCCAGCGGCGCGGGTTATGGTGGCCCCCCGGGTGGTGGCGCAAGACA

Sequences in the Contig:

SY0AAA16YK01FM1 SY0AAA47YO21FM1 SY0AAB60YA07FM1