Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1819
Length(NT) : 944
Best Gene Model Blast : Link to GSTUMT00008818001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_07546
Accession: ref|XP_001590922.1| Score: 215 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: fgr:FG01051.1 Score: 192 E_value: 3e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1819
TTGGGCGGATTTGCACGCTCTTGTCAATGAATGGGAGGACGTACGGTCCT
TTCTCGCAATGAGCCTTGACCGAAACGCCAGCTCACCGCCCTCAAAACCC
CCGGAATCCGTCGGTGGAACCACATTGGTGGGCGATACGCCCAGGAATTC
CATATTGTCTGGAAGTGGTGGCACCGGGTGGGCGGACGATGCAGGGTTCG
GCTTATTTTCGCCAACAACGGAGGATAGAGAACGCCTTTCCGAAGACGAG
CAGGTGTTTGAGGCTGTTGCTGAGCCTAGGCCCCGGAGTATAATGACGCG
GGATGAACGCATTCGCAAGGTCCAAGAGGAGAGAGTGAGAATCGCCGAAC
ACAAGAAGAAAACTGAGGCCGGATTGGCACTTCAGAGAGAATTGCAAGCG
GTGCTCGTCAATCGCCCACCCTCAAGAAGAAAGCCCATAGCAAGTCGTAA
TTTCAGTACCTAACCAGCCGCTATCTCGGTTGACCACTACAATCGCTCCG
GACGTCCAACCCTTTCTCTGACTGTGCTGTAGTGATTTCCCTTCCCTTCC
ATCTTGCTGGGCCCACATACTCATGGATGTTTATTCTATCATTTTGCCGG
ATTTGTTTTCCCCTTGCGAAGCAGCGGCGGGCGTTTTGGGGTGTTATGCC
TGGAGTGTTACGATTTGTGGCTGAGGACGCCTACGATTTGATGAGGAAAA
TTAAATTATACCCCTCCTCTACGCGACATTGGACTTTTTGCCTTTTTTGC
TGTGCTGTTTTGTTGCTATGGGTTACTCTAATTTGTCCTTTTTCTTGTGT
CTACGTTTGTCCCCATAACTTTGGTATCATGCCTCGCAGTTCTACAATTT
GCTTCACTTTCCCCTTCTAGTTCGAATTGTATAGTTTAGTCACTAGTCCC
TCTTTTAAACCCCCCGAAACCTAAATAAAACAAACAAGATCATC

Sequences in the Contig:

SY0AAA27YI09FM1 SY0AAA63YI14FM1