Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1818
Length(NT) : 677
Best Gene Model Blast : Link to GSTUMT00007851001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Patatin-like serine hydrolase, putative
Accession: ref|XP_001260301.1| Score: 242 E_value: 5e-19
KEGG Definition: Patatin-like serine hydrolase, putative
Accession: afm:AFUA_2G07870 Score: 242 E_value: 3e-19
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG4231 Score: 176 E_value: 7e-14
PFAM Definition: Patatin, Patatin-like phospholipase. This family consists of various patatin glycoproteins from plants. The patatin protein accounts for up to 40% of the total soluble protein in potato tubers. Patatin is a storage protein but it also has the enzymatic activity of lipid acyl hydrolase, catalysing the cleavage of fatty acids from membrane lipids. Members of this family have been found also in vertebrates..
Pfam Number: pfam01734 Score: 135 E_value: 4e-09

Sequence:
>Contig1818
TTGGGGACCACTCACTCGTACACCGACTACCACCTTACACTACACCACTA
CGACTAGCATCTAGCTCATGATCTCTCCAAACGAAACCGTCCGGAGGGGT
GGTCGCGGCCTGTCCTACGATCCTGCCACGGGAACTTACACGCGCCCCCG
CAAATCGTCGCAGACGGCGCCGCCACCACTACCACCCAAAGAGATAGACC
CGTCATACTCGAACGAATACATTTACTCGCCCATCACCAAGGAGACTCAC
CGAGTCGCCGAACTCGACGGCGATTCTGATGCGGGAAGATTAGATTTGGA
GGACAAGCTGGGGGACTCATCCAAGAGCGAGCAGAGACGATGGAAGGAAA
AACAGAAAGCCAAGAGATTACCGAAAAAGAAGCGGCAACTGAGAATCTTA
TCACTAGATGGCGGCGGAATAAGAGGTTATTCTACACTTGTTATCCTTCA
AGAGTTGATGCACCAGATATATGTCCAGACTCATAATGGGAAAGGGCCCA
AAACTCCTGCCGATCTTCCTCGACCATGCGACTACTTCGATTTGATTGGT
GGCACTGGGACTGGGGGGTTGATCGCCTTGATGTTGGGGAGGATGAGGAT
GGATGTTGAGAGCTGTAAGGAATACTACGTGCAGTTAACGCGTTATGTTT
TCATCACAGACAAGACTATTTTGGGAG

Sequences in the Contig:

SY0AAA63YI03FM1 SY0AAB52YH23FM1