Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1817
Length(NT) : 1110
Best Gene Model Blast : Link to GSTUMT00008884001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_04756
Accession: ref|XP_001795168.1| Score: 410 E_value: 4e-38
KEGG Definition: hypothetical protein
Accession: ncr:NCU03221.1 Score: 365 E_value: 3e-33
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2273 Score: 185 E_value: 1e-14
PFAM Definition: PX, PX domain. PX domains bind to phosphoinositides..
Pfam Number: pfam00787 Score: 211 E_value: 1e-17
Swissprot: Q5KJJ8|SNX4_CRYNE
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane

Sequence:
>Contig1817
TTGGCCGCCCCCGCCCCCGTAACCCCCCACGTAACAACTGACCTTTAACT
TACAAGACTTTCTATACTGGCCGATATCGATCCCTTTTAACCCTACATAA
TTTCCACGACAGCTCCCCTATCGCACCATGTTCTGGTGCCAACAACAGCA
GCATCCCTCGCAATCATGAACCAAGGGAAATCACACTCAGGAAGAAGCCG
CATACGATCCGTTGAAGATCGCTTCCATAAAGATGGTGGCGAAGCACTCA
AACCGATGCCTATAACGCTGATTGATCATACGATCACACCGAGTGAGAAC
AGTCCTTCGCTATGGGCCAGAAGTGCGAAAGTTGTCGACTATGTTATCGT
TGCTGGGAGTAGGACAAGAGCGGGGGCTTATGTTGCGTGGAACTGCTCGA
TAGAGACTTTTGAGGGGGTCCAATTCACAGTTCGCAAAAGATACTCGGAA
TTTGTAACCCTAAGGGACATGCTGCGGGAGACCTTTCCAAGATCTCTGGC
TTCGTTACCCACTTTGCCGCCAAAGAGTGTTGTTTCAAAATTCCGGCCAA
AATTCCTCGAAGTACGGCGTCAGGGATTGTCGTACTTTTTGTCGTGCATC
CTCCTGAATCCTGAGTTCGCTGGTTCGCCTCTCGTGAAGGATTTTTTGTT
TAGCACCGACGACGACTAGAGAAAAAAAATCCTGCACTTCTACCGTATAC
GGTTTCCGCCTTTCTTTATAATATCTCCCTTCTCTTTGAGCACTTTGGCT
TTTTCAACCCCAAGTTACCCTTGCAGTCCCAGTTCACCAGACAGTTTTTA
TTTTGTTAATGATATATTTTATTTACTCTTCAATTCCCGATAATGTTTTT
CCATGTATCATAGATGTTGCGGCTTTCTCGGTCTGCGGGTGCCGTATTCG
TACGGCACTATTGTACTGGTACCGTACCGGTGGCGTGCTGTGGGATTGCT
ACCAAATTCCCCCCCTCTCTCTCTCTTTGGCGTCGATGCTTGTAAAAATT
CTCGTGGTTGGCTAGAAAACGGAGTCGTCGGCTGAGAATCGGAGGGTTGT
ATGATATGAGCTCTCAGGAGTGAACCAAATTGAAACAACTGTTCTATGTT
TTTACCATCT

Sequences in the Contig:

SY0AAA63YH21FM1 SY0AAC26YO20FM1 SY0AAC45YF07FM1
SY0AAD33YJ23FM1 SY0AAD38YD16FM1