Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1815
Length(NT) : 1001
Best Gene Model Blast : Link to GSTUMT00006114001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1830 Score: 131 E_value: 2e-08
PFAM Definition: No Hit Found

Sequence:
>Contig1815
TTGGCGGACGAAAGAGGGAAGAGGAAAGGAATAGGAGAGGAAAGAGAGAA
AATATCTACGACATTAAACCGTCCCACCTCGCACATCGGGATCCACAACA
CGAGACTTCACCCTATCACTCCAATAGCCCGGCATCCTTATATCACTCCA
GTCAGCACAAACTTACCACGACGCGGAAAAAAAAATAAAAAAGCGGTAAA
ATCATTGAGGAAATCCCCTATCGAGTTCCCAGATACCGGTAAGCCAGACA
GAATAAGAAGGCCAGCCAGCCAGCCCCACCAACGCAGCTGCAAGCACAGC
ATTTCGTTATCAAAGATAAGAATACCCGCTTCAATGCCATCAGCCGGTCG
ATCACTACCGACGACTCGTCCGAAATCATGGCGATTACAGCGTCCCCACG
ATAAGGGTAACATTGCAAAAGGCGATCAGGAAAAGTACCAGCATAAACTT
CTAAAAGCCGTCCAAAACTTCGTCATAGGCGGTAATCAGCCAAATCTCGA
TATAATCGCAATCTCCTTTGAGCATAAATGTTTCAGTGAGGCCAGAAACA
GAGCAGAGTACATATCTGCGATAAACGCCAAACTCCGCGAATGGAACTAC
GACGATATATCTGACGATGACACCGCACCCTCCTCCTCCCCACAGCCTAG
CATCAAAAAGCAAAAAACAATCTCCCCGTCACCATCCTTACCCACCGCCT
CCACCAACACCATCCGTAGCAACACGACTACCACCAACACCGCTACCAAT
ACCAACTCGTCCTCATCCCCGAGTCAGCCCTCCAGTCCGCCACTGGCCAC
TACCCTTACTTCCGATGGAGACGTCCAAGACCATGACCACGCATTTACCC
ACACCTCCGCAAGGGAAGATACCGGGTGGGGGAGGAGGGGGGGGCTTTGT
GCAATTGTTTGATCCCAAGGTGCTCGACAAGATCGACTTGAACGACCCGG
TGAAACGCACAGAATGGGTCAGGGCCGTGTGGGAGTACTTTAGTGGTGGG
G

Sequences in the Contig:

SY0AAA35YP17FM1 SY0AAA63YG22FM1 SY0AAB43YG09FM1