Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1814
Length(NT) : 1002
Best Gene Model Blast : Link to GSTUMT00010895001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein CIMG_09746
Accession: ref|XP_001240125.1| Score: 601 E_value: 2e-60
KEGG Definition: hypothetical protein
Accession: ncr:NCU07724.1 Score: 535 E_value: 5e-53
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P47025|MDV1_YEAST
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane
GO:0000266 = Biological process: mitochondrial fission
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig1814
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCTTCACTTGTAACTACTTG
CCCTGGGTCTACTATCTTCTCTCTCTCCCACTACCCAGATTCACCTCGAC
AGCGATAGCGAGCCCCTTTACACATTTTTCTTCTCCACACATTTCTTCCA
CCGCTTATGCTGTAATTTATCCACTGCATTGTCACAATCGTTCCCGAGTC
GCCGCCTCTCTCTTGGAATGTCATGGCTTCTAATACTGGTCATGGCAGTT
CCCCTTCAACACTGGACCGTCCTAGAACTGAAGAGGGTGACGCAACAATC
ATAAGTAATGCATTGACCAGTGTTGCGGGTCAGAACATTTCGGCTTTCGG
CCGTACCGTCTCTGCAACTGCTGGAACTCTCTTTACGGATCCAGCCGCTC
CACCCCAACACTATGCCGCCGCAATGTCTGATATCTCCAAACAATTATCG
CACCGCCCTTCTCTCCAGCGCCGCGTGTTTTCGTTTAACAAACGCTCTCC
AACGGAGCTTGTGCGGTCGAAACTGTCTACCGCCGAGATACAATATCGAG
CGTTAACCTATCTACCGGATGAACTGCTCAGGAATATCCCCGATAATGAG
AATTCCTATTCCCTCTTTCAGGGCTTTCAGGCCTCCATGCCCGAGGAGCA
CCAGAGGGTGGGGAAGAACCACCCACGCAAAGGCTCAAAAAACAAACTTT
TGGAAGCCTCGAATGGAGGCGAACCAGACACACCTCTCGGAAATCTCAAG
CGTGAAAAGTCCACCATGGCAAGACAGTTGGAGATGTTAAGCATCAGGAA
AAACATGGCATCATCGGAAATTAGGGAGATAGATATGAAGATATCAAACC
TGAATCAAATGCGGAACATCGTCCTGGATCGATTGGCAAAATTGGAGCAG
GACGAAGCAGAAGCAGAGCACGAGATATTGGTTCTAGAAAATAAAATTGA
AGACCTCCAAGAAGAACTCGACGAGGAAAATCATCACTCCACTGATCCCG
AA

Sequences in the Contig:

SY0AAA63YG18FM1 SY0AAB39YI11FM1 SY0AAC1YB10FM1
SY0AAC36YB11FM1 SY0AAC52YI16FM1 SY0AAC59YF12FM1
SY0AAC8YD10FM1 SY0AAD62YE23FM1