Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1813
Length(NT) : 1034
Best Gene Model Blast : Link to GSTUMT00007071001 E-value : 1e-132
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1813
TTGGCTTTAAGTCTTCAGATTTTATTGTGGTTATCATTGTTACTTCGTTA
TCACAACAGTTAGTACAATAGATACAAATATTTTCAATACCGATCTCTGC
CGAGGTCGTGGATTCACCACGCTGTATAGCCTCTTGTTGGTGCCCGTGGG
TGTGATAGGTTCGTGGACCGGTGTCTGGGGAGATACGCTGAGCGATAATA
TCGTAACCCGGGGACCCGGCGTAAGGGAATTGTACGCCATGACTTCGGTG
TAGTGAGGTGCTGGCGGGGGCCAAGGAACAGCCCCAAGCGCTCGCCGTCC
GAGGAGTCTGAACATGTTACTATAGTTTTTGTCTCCCGAAAGATTCCCAC
TGCTCTCGTGACTATTCACAGTCTAGTTATTTCAACCTCGTACGTATCAG
TTCCCCAGAATCAAGTTCACCCACTACTATATGTTAGCTTTGTAAGAATT
GTTATAAGTTAGCCTCTATCCCACGCGCCTCCCCAAATGTCCACCGGCCT
TTTGAGCGGCCCTGTCTAGTCTCTCATCTCCCAATAAAATGATATTATAT
CCAGCTTCCCAATATCCAGTTCAAGCGACACACCGCACTAAACAACCGCT
ATCATAACATCGCCGTCCAAGCGTTGTCAACCTTTTCGAGCTTGTTTGAA
TCAGAGAGAGAAACTATTGTAGGAAGGGGTAGGAGAAGGTGATTAGATCC
CCAACTCACCGGAGAGCTTATCGTTACATGTCAGGCTACACGGCAGCTCA
CTCAAAGAAAGGATTCCGAGGGTTTTCCTCATAGATAAGACTCGCTTATC
AGGATCATTAAGATCGACAAGCCTCCGATGATCTTTGGCCCCCAAAACTC
TGGAGATTTGATCAGACGGGAACAGGACTGGGTTGGGTTTGATACTGGTG
TCCGAGATGCAAGCGCAAAAAGTCCCCATCGTGAAACCAAACATTCAGAT
CGTGATACGGTGGTTAATTCGTCAGCCTTATCTGGAGCAGAGCACGAGCC
TGAAATATTACGTGAGAGGGTCGTCGTATGATAT

Sequences in the Contig:

SY0AAA52YF20FM1 SY0AAA53YB23FM1 SY0AAA63YG12FM1
SY0AAB14YG21FM1 SY0AAB38YM17FM1 SY0AAB38YP04FM1
SY0AAB51YJ07FM1