Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1811
Length(NT) : 747
Best Gene Model Blast : Link to GSTUMT00004607001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_08814
Accession: ref|XP_001590050.1| Score: 640 E_value: 4e-65
KEGG Definition: hypothetical protein [EC:4.1.1.2]; K01569 oxalate decarboxylase
Accession: ani:AN8099.2 Score: 632 E_value: 2e-64
KOG Definition: No Hit Found
PFAM Definition: Cupin_1, Cupin. This family represents the conserved barrel domain of the cupin superfamily (cupa is the Latin term for a small barrel). This family contains 11S and 7S plant seed storage proteins, and germins. Plant seed storage proteins provide the major nitrogen source for the developing plant..
Pfam Number: pfam00190 Score: 125 E_value: 6e-08
Swissprot: O34714|OXDC_BACSU
Gene Ontology:
GO:0046564 = Molecular function: oxalate decarboxylase activity

Sequence:
>Contig1811
TTGGTCTTCGCATCCTACATCCACCATGTCCCCAAAGTACTATCTTCTCC
CTCTATTTCTTAGGCTCGTTGCGGTAATGTCTGCTCCGGCCCCGCCCCTT
TCACAGGCTGCTACCAAGACATATGCAGTCTCGGGGGATCTCCGAGGGCC
CACGTCCCTACGGGGGTATGACCCGGAGCTTCCATTTGCAACGGAGAGCG
CAAACCGAGCGCCAGTGCAGCTTGCACCTGGGCAAGATGAAGATGATCCG
GAGGGTCGTATTCTAAACTTTGAGAATGTTACCGAACCGCAGCCATTGAG
AGGTACCCGCGGTGGTACAATTGCCAGCAATCATGATGTCGAGCTCGAGA
AGTTACACCCAGACTCCTTCGCACCACCGACAACAGATCATGGTGCTGTC
AAACAGGCGGAGTGGCCTCTTGGGTTGAGCCATGTCAAGCTCGGATTGGA
GAGAGCTGGATGGAGTCGACAGCAGAACATCAATGTGCTACCTTCTGCCA
CAGAAATGGCCGGCGTCAACATGAGACTTGAGGCAGGAGGATACCGTGAA
TTACACTGGCATACTGCTGGAGAGTGGGCCCTGATGTTGAATGGATCAGC
TAGAATCCAGGCTATGAATGTCGACGGTCAGACATTCATCGATGATGTCA
CCAAGGGAGATGTTTGGTTCTTTCCTAGTGGTGTACCCCACTCCATTCAA
GGCCTCGAGAACGGAACCGAGTTCTTGTTGGTCTTCGACGACGGCGA

Sequences in the Contig:

SY0AAA63YE09FM1 SY0AAB43YD06FM1