Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1810
Length(NT) : 632
Best Gene Model Blast : Link to GSTUMT00011958001 E-value : 1e-132
Numbers of ESTs : 2

Blast Results:

Nr Definition: 14-3-3 protein
Accession: ref|XP_001553570.1| Score: 347 E_value: 3e-45
KEGG Definition: hypothetical protein
Accession: ang:An18g06270 Score: 347 E_value: 2e-44
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0841 Score: 313 E_value: 8e-30
PFAM Definition: 14-3-3, 14-3-3 protein..
Pfam Number: pfam00244 Score: 348 E_value: 7e-34
Swissprot: Q96300|14337_ARATH

Sequence:
>Contig1810
TTGGGCCTTCCTCCACCACTACCACCCCCACAAACCACCCCCACTGAAAA
CCCCTTCCACATCCGCATCTTCAGCTGCTATCAACAACCTCCCTCCCTCC
CCTCCTCCCCCTCATCCTTCAACTTGCGTTTAATCTCCAAATAAATACAC
AAACATCTAAACTCCACCAAAACATCATGACTACCGAGCGCGAGAGCAAG
ACTTTCCTCGCCAGATTGTGCGAGCAGGCTGAGCGTTACGATGAAATGGT
TACTTATATGAAGGAAGTTGCTAAGGTATACATAACCCTAGAGCTGACAT
ATCTATCGTTACAACGATAGAATTCCTGGCATCCGATCGGCCCGATCGGC
TCCATAGATTTGAAGCTGAATCCGGCGCTAACTGGTGGTTTTATCAGCTT
GGCGGCGAACTCTCCGTTGATGAGCGTAATCTACTTTCGGTTGCGTATAA
GAATGTTGTCGGAACCCGTCGTGCCTCATGGAGAATTATCTCTAGTATTG
AGCAGAAGGAGGAGACCAAGGGTTCTGAGAAACACGTTACGAAAATTCGC
GAATATCGCCAGAAGATTGAGACCGAGCTGGAACAAGTTTGTGGTGATGT
TCTCAATGTCTTGGACGAGTCTTTGATCCCTA

Sequences in the Contig:

SY0AAA63YD20FM1 SY0AAC27YA07FM1