Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig181
Length(NT) : 121
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig181
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGCCGCACAACTTTGTACAA
GAAAGTTGGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTT

Sequences in the Contig:

SY0AAA16YJ14FM1 SY0AAA39YA07FM1 SY0AAA61YM01FM1
SY0AAB29YH21FM1 SY0AAB35YI19FM1 SY0AAD17YO07FM1
SY0AAD40YG22FM1 SY0AAD56YG11FM1