Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1809
Length(NT) : 912
Best Gene Model Blast : Link to GSTUMT00006859001 E-value : 1e-166
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_11036
Accession: ref|XP_001550628.1| Score: 413 E_value: 1e-38
KEGG Definition: hypothetical protein
Accession: fgr:FG09405.1 Score: 381 E_value: 3e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1809
TTGGCCGCAAGCAAACGCTTCCCTCTTTGAAAATTTCCAAGACTTTTTAA
CTGCTACAACCGGTACTCGAGTACGGTACTTGTACTTGTACCTCTCGGGT
ATCATAATAACCAGCGTTTACCACATTTCCAGTTGTACTGGCTATACAGC
AAACTTCTAATACTTTGCGATCGGCACCGGTATTGGACGCGCGTACAGTA
AAATGGCCCCGGGGCCGGAACAAACTTCCCCACCTTCAGCTCCAATCTCC
TCTGACAGAAGCCCCGAGGAAATGGCGAAGGCGGCCGTTGAAATTCAACG
GCATTACAGAGGCCATCGCGAAAGACGCCACCTAAAGGGCCATGGATTGA
CACCAATGCAACGCTGGAATGATGCTTTGGAAGAAGCTGAGTACCGACAA
GTTGCTCGACCTGTTTCCCTGGAGAGGAGGGTTGAATTGAACAAACAACG
AGAGGAGGGAGGAGGGGGTAGTGCGGCACTGGAGCATGGGAGAAAGGTTT
CGGGGTCAAAAGAGATGTGGGACAAAGCCGTTTTGTTTGCTAAACGGGCA
CAACATGACGACCCCGACGATACCGTTTCTGAGAGCAGTAACGACTGCGA
TAGCATTAATAGCAGAGACTCTGAAGGTACAAAAAAAAGGAAGGCGGAAG
AAAGGAAAGAGAAAAAGAGGCAGAAACGTTTGGAGAGGATTGAATATTCT
AAAGCTATGGACATGCAATATTTTCTGGAAATGGTTGATCTTAAGCACCG
TTATGGCTCAAACTTGAGAGCATACCACTCTTACTGGCAACAGCAAGATA
CAAAAGAGAATTTCTTCTACTGGCTTGACCGTGGCGAGGGCAGGGAAGTC
GACCTTAGTGTCTGCCCCCGTGAACAGCTAGAGAAGGAGTGCGTAAGATA
TTTATCGAGGGA

Sequences in the Contig:

SY0AAA63YD10FM1 SY0AAB17YI22FM1 SY0AAC56YM21FM1