Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1808
Length(NT) : 1269
Best Gene Model Blast : Link to GSTUMT00011024001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_05286
Accession: ref|XP_001556517.1| Score: 591 E_value: 5e-59
KEGG Definition: hypothetical protein
Accession: fgr:FG05598.1 Score: 524 E_value: 1e-51
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3281 Score: 423 E_value: 4e-42
PFAM Definition: ATP11, ATP11 protein. This family consists of several eukaryotic ATP11 proteins. In Saccharomyces cerevisiae, expression of functional F1-ATPase requires two proteins encoded by the ATP11 and ATP12 genes. Atp11p is a molecular chaperone of the mitochondrial matrix that participates in the biogenesis pathway to form F1, the catalytic unit of the ATP synthase..
Pfam Number: pfam06644 Score: 473 E_value: 6e-48
Swissprot: P32453|ATP11_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0051082 = Molecular function: unfolded protein binding
GO:0033615 = Biological process: mitochondrial proton-transporting ATP synthase complex assembly

Sequence:
>Contig1808
TTGGGTGCTTCAAAGACCTGAAGCCCTCCTTGCCTGCAGCCGGGACACTG
ACCCCAATTGTAAAACAGAGAGTTTACCCATATATTCGTGGACAATGGCT
TCCGTTATTCGACCTTTTATAACCCGCCGTGTAATCGTTCCCCAGTTTAA
GATCGCTCCGAGAATCCAACGTCGGAATGCCCAAGTCCTGAACGTCCGAT
TTCTGCAAACACCCACAGCACCCCTGGTATTAGAGAAATATCGTGAAAAG
CTGGAGGCGAAGCTAAAAAGCGAGGGGTTAGGTTCGCTTGAAGAACTTCG
AGAAGTATATCGGGATAGGATTGAAAATGTGCGGAAGGAATCTGCGCCCC
CACGCTCCCCTATCGACCCACTATTACAAGATCCTCCCCCACCTCCTCCA
TCCCCCCAACCTTCTTCATCTGTAGAGACCGCTTCTGCATCCTCGCCATC
TTCTGTTCAAACGGGGGGGGCAAGGTCTACTGATGCCCCACCCCCAGGCG
TGAAGACACTCTCGTCGTTTGTCGATGTGGACAGGCTCACCGCGCACTCT
GATCCGAAGGAGATAGAATTCATATGGAGAGCTCGCTTTCTCGATGATAA
GAATAGTCTCTGCGCAGTGATTCCTAAGGATACATATGCCAGTCTTGAAG
AGTCTGCTTGTCAATACCCGATGTTCATCCTCCCACTCCCACGGGATAAT
GGTGCCGAAATGCACTTCCTTCAATGGACCTTCCCAACCCCACGTACCTC
TACAATTATCTTCGCCTCTCTCGCCGAGTACAAGTTGAGGGGGGAATTTG
CCGTCCCGCATACCACGTTCTCTCACCATCTCGAACTGGCAGAAGACAAG
GGTATTGTGTTAGCACAGGGCGCTGTGACACCTGATAGAGGGGTTACTGC
TAATGATGCTCGATGGCTAGTTATGGCCCTCCAGAGGTTTTATGGGGCTC
TGGATAGCGAGGAGAGCGGAGTGAGGAGGAAAAGGCTGTTGGAGATGTTC
TCGAAGGGTGATGACGGGTTTAAAGTAGAGAGCTTGATCGAAGAGGTGGA
GAAGTGGGGTTGATTTCGTTCATGGGTCTCGATTTATCGATATAGGTCCT
GTGAGACGTAAGTTACTGTACATGTAGATGACAAAATACACAGAAGCGAA
TCATGCGATGTCACTCGAGTTATCCTGTTTTTCGCACAGACCGGTGCTCG
CAACCGATAGACTATGGGGCGATATGTTGCCCTTCCGTGTGGCTCGCCAT
TCTCCGCCCCTGGTGCTCA

Sequences in the Contig:

SY0AAA33YH21FM1 SY0AAA63YD04FM1 SY0AAC50YO03FM1
SY0AAC6YH10FM1 SY0AAD49YC16FM1