Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1806
Length(NT) : 1067
Best Gene Model Blast : Link to GSTUMT00003785001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_02718
Accession: ref|XP_001793315.1| Score: 936 E_value: 4e-99
KEGG Definition: Golgi phosphoprotein 3 (GPP34) domain containing protein
Accession: afm:AFUA_1G06630 Score: 907 E_value: 4e-96
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3983 Score: 625 E_value: 1e-65
PFAM Definition: GPP34, Golgi phosphoprotein 3 (GPP34). This family consists of several eukaryotic GPP34 like proteins. GPP34 localises to the Golgi complex and is conserved from yeast to humans. The cytosolic-ally exposed location of GPP34 predict a role for a novel coat protein in Golgi trafficking..
Pfam Number: pfam05719 Score: 646 E_value: 4e-68
Swissprot: O14205|YDQD_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1806
TTGGGACGCCTCAAATACGAGTAATACTGCTCATTGAACTCGCAACCCTA
ACTCTCCTCCAACAACCCCCCTCCTCTCGTCCATGGTATCGTGCTACAGT
AGTTGCACCCAGTCCTACAAGCACTTGACACAGCCAACCCGCGTCCCGTC
ATACCGCCGATAAACCCTTCCAGTATCATACCTCCTAAATCATCTCACTG
TCGTCGCGTACCGCTTCTACCTCTCATCACTCGACAAACTACCGCAAACC
TTCAGCAGCGTGAGGTGCCCCGTAGCACGGGTACAGCCGAGTTAATCGAT
CGAAAAAGCTATCATACAATCTACATATTATGGCGTCGAATACCGGTTTG
ACACGGAGGAGAGGTGGTGGTGGAGGTGGAGGCTCGGCTGGAGACGAAGT
TGATCGCAGCAGTTCACCATCTACTTCTAGACCAGCGGAACCCCGAAGCG
GGGAGACATCATTCACTACTGCTGAGAATGGACATAAGATTGCTTTTGAT
CCCAGAGACATCAGTGAGAATCAGGAGAGGAGTAAACAACCAAAGCTTAC
TCTAATGGAGGAGATATTGCTTCTAGGTTTGAAGGACAAGCAGGGATACC
TTTCTTTCTGGAACGACAACATATCTTATGCACTCCGTGGTTGCATCGTT
TTGGAGCTTGCCTTTAGAGGCCGTGTTAGCATGCAGAAGGATTCTAACAG
AAGGAGATTCCCGTTATCGGATAGGATAATCGAGGTGATTGATGATACTC
TCACCGGAGAAGTGTTGCTTGACGAGGCTCTGAAAATGATGAAAGCAAGC
GAAAAGATGAGCGTGAGCTCCTGGATCGACCTTATGAGTGGCGAGACCTG
GAACCTGATGAAAATAGGATACCAGTTGAAGCAGGTCCGCGAGCGCCTAG
CCAAGGGTCTAGTAGATAAGGGAATCTTGCGCACAGAGAAGCGTAACTTT
CTACTTTTTGATATGGCTACCCATCCGGTTGCAGATGGCGGAGCGAAGGA
TGAGATAAGACGCCGTGTCCGAAATGTTCTTACTTCTCGCACAGTTGTCT
TGCCCGGAAATCCGTTC

Sequences in the Contig:

SY0AAA26YB04FM1 SY0AAA40YB14FM1 SY0AAA63YA20FM1
SY0AAB20YC10FM1 SY0AAD10YB14FM1 SY0AAD40YJ23FM1