Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1805
Length(NT) : 940
Best Gene Model Blast : Link to GSTUMT00012075001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: protein kinase dsk1
Accession: ref|XP_001213975.1| Score: 325 E_value: 2e-28
KEGG Definition: hypothetical protein
Accession: ang:An14g02230 Score: 324 E_value: 1e-28
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1290 Score: 255 E_value: 6e-23
PFAM Definition: No Hit Found
Swissprot: P78362|SRPK2_HUMAN
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005524 = Molecular function: ATP binding
GO:0000287 = Molecular function: magnesium ion binding
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0007243 = Biological process: protein kinase cascade
GO:0000245 = Biological process: spliceosome assembly

Sequence:
>Contig1805
TTGGACCCTTGCCACCCAGTCAATAAGCAGGACAAGGGGAAAGAAAAAAA
TTGTTCGACAAAACCATTTCCACCCTTACCCGAACACCTCTCCATTAGGG
TACAGCTATCGCCAAGCTGGAATTTTCGCTGCTCTCTGCTTCCCACCTCA
GGGCAATCCCCCCCGCCTCCCACTACCCTTCTAATACAATCACCGCTTCC
ACCCTCAACTCTCTATCAACTTCTCCATCACCTCATACGCCTTCTGTACT
CGATTCCCTTGCACTCTCTCCTTCACCGTAAATAAAAATAAGAAAAATAA
AAAGAGAAGAGAAAAGAAAGAAAGAGAGAGAGAAAGAGAGAGAGAAAGCA
GAAGGCTATCGGCAGCAGAAGCAACACATCACGGCCAGCGGTTGGTACTC
TCCCCCCTAAGAAAATCACAGAGAGAAAACGATGAACGGCGACGTCGGTG
TCAAAAAAGCCACAATGAATAAGATGAAGCAAGTTGCGAACGCGGCCACT
GGAAGCGGCGCTATTGCAAACGGTAACAAGAAGAGGAGAAAAGGTCAGGA
TCTGAAGCCCATCATCACCGGGGAGCAGCAGAATGGCAGTTCGCCGCCCG
TACCTGCGACCGTTGCGGGTGACAAGCAGAGTGATGTAAACACACAATCT
CTATTATCGCATCAAAAACCAACCTCGACCGTTGCCATTACTACTACCCC
ACCCAATGACACACCCACATCCGCGACGTCTGCAAACTCTAGAGTCTCGT
CATCATCACGGACAGGCGAAGAGGATGAAGGGAACACGGCTGACGAGGAG
GATTACGAGGATTATTGTAAAGGAGGATATCATCCTGTCACGGTTGGAGA
AAAGTTCAAGGATGGCAGGTATGAAGTACTTCGGAAACTAGGGTGGGGTC
ATTTCTCTACCGTCTGGCTATCGAGGGATGAACGGACCGG

Sequences in the Contig:

SY0AAA61YC14FM1 SY0AAA63YA08FM1 SY0AAC27YM11FM1
SY0AAC42YO15FM1 SY0AAD38YL23FM1 SY0AAD46YD01FM1