Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1804
Length(NT) : 1874
Best Gene Model Blast : Link to GSTUMT00002459001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein FG10820.1
Accession: ref|XP_390996.1| Score: 258 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: fgr:FG10820.1 Score: 258 E_value: 2e-20
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1596 Score: 123 E_value: 3e-07
PFAM Definition: No Hit Found
Swissprot: Q09871|YAG7_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1804
TTGGACCAAACTGGTTTCTACCACAGATTTACCAGCTCTTCTCACCCATC
GCCAATTCGTGTTCGGGTATCTTTCTATCTGTTCTCTTGAGAAATACTTC
ACCTTGACGCAATGTCCTCTACTACTGCAGTCACACAACCAAATGCCTCC
CGTGGAAAGAAGAAGGGCAAAGGAGGTGGGGGAGGAACTCCATCCCCTGC
CCCCGAATTAACACAGGACAAAACGGCCGACTCTACAAATGATGTGAAGG
CTGGTGAGAAGGGAGAGAAAGAGTATTTGAAGTGGATCACGAAGCAGCTC
AAGAAACACACCAAAAAACTTGATAGTATCGCAAAGTCCGAAGAGAAGAT
CAAGGACCTTCCTGAAGAGGAGAAGGCTACTACCAAGATCATCAACGTCG
ACGAGCGCAATAAAATCATTGGAAAGCCCGTTACTCTTGCCGTATACAAG
GAGCTCAAGGAATGTTACGAAAATCTTTTGAAAGCTTCTGAACTGGAAGA
CAAACGCCTGGAAGCCGAGAGAGTTGAAGCTCAGGCAAGGCTCGAGAAGG
CTGTTGAAGAGGCAAAGGCTGAAGCGCAGAAAGAGACCGATGAGGCCGCC
AGAGCCAAGATCTTGACTGTCGTTAAATTTTTGAGACTTGCGGGGCATCG
CCGAAACAATAAGAGTGTCGACGAAGATGAGGATGAAGCCATTGAGAGAG
TCCTCGTTCTTGTGTATGGTGGTGACCAGAGCGCTATCGATGCCTGCCTC
AACCTTGCTAACGGCTCCGAAGAGCCGGTCGACGGCTTTCAAGTTTCTTA
TTCACGCATTAAGGAAGTTGCCCATGCTCTCAAAATTCAAGGTGTTGACG
AGGAGGATGTTGAAGAGACCCTGGAATTTGCCGAGGAGCCGGAAACCGAA
CAACAGCAAGATCAACGAGAGGAACTACCTACTTACGAGGCGTCTGCTGG
AAATGAACTCGACCTCGCTGCGCAGGACGAAAAAGTGCCCCTCTACACCG
AAGGCGCCGCTGAGGACATGCAAGCCCCTCCCCAACAAGCCTATACCAAC
GGAAACGAACATGAAGCACCTGCGACTGCCCCCGGCGCATCTATCGCCGA
CGGTGATGCCACTAATTACGCATCCAAGGAGGTTGAATTGGAGGGCATCG
AGGACCAAGTACAGGCACAGATTACCGGAGAAACACAGGCACAGGATGCA
CCAACAACACAGCCTGCTAACGGTGAACCAACCGGAGACTCTTGGGCAGA
TGATCAACCAAAGACCCCAGAGGTCAGCGATGAGTTCCAGAATGGTTGAG
CGCCGTGGTAGGGGGCGTGGGTATCGCGGTCAAGGAAGAGGGCGTGGACG
TGGCTACAGAGGGGATAGAGGTGGTTACCGAGGGGATAGAAGTGGTTACC
GCGGCCGTGGAGGTCGCCACCGCGGCGAAGGAGGGGATCCCGGAGACCGT
CCACACCGTCCCAGACCGAAAAATACTGACCGCCAACCCCAACCCCAACA
AGCCACCACATCTACCTAACCGGTTGGAGTTGATCATGATTTAGTAACTA
ACTGCATTGTACTCATATCCTGTTCTACTACTGTCTGTAATTTTCCCTTG
CGATTGATATCTCTTTGTGTTTTCTGTTCTTGCTTCACTTTAGTGGGGAA
GGGTTGGGGGTACAGAAAAATTTGAAATCTGCGGGGACTGGCCATGTTTT
CATGGGGAGATGTAGGTGGTTTGGCTGTGGGTGCATCGTAGTCGCTTTTA
GTTCGGAAAACAACCAAAACGAAAAGTTTCTTCCTTGAGCTTCTCCCTTT
TTTCTCCTTTCCTCCTTTTTCTTTTTCATTTGTGCTCCAGATAAAACACA
GGATATGGAGGACAAAAGTTTGGG

Sequences in the Contig:

SY0AAA42YL24FM1 SY0AAA62YO22FM1 SY0AAB18YA20FM1
SY0AAC11YD16FM1 SY0AAC16YC05FM1 SY0AAC40YM22FM1
SY0AAC44YO11FM1 SY0AAC46YF01FM1 SY0AAC48YD07FM1
SY0AAC55YN16FM2 SY0AAC55YO24FM3 SY0AAC5YK10FM1
SY0AAC61YG15FM1 SY0AAC9YF06FM1 SY0AAD15YM11FM1
SY0AAD58YK07FM1 SY0AAD6YN12FM1