Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1803
Length(NT) : 1366
Best Gene Model Blast : Link to GSTUMT00003074001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63327.1| Score: 1233 E_value: 1e-133
KEGG Definition: actin-binding protein SLA2/Huntingtin-interacting protein Hip1
Accession: aor:AO090020000087 Score: 1233 E_value: 1e-133
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0980 Score: 873 E_value: 3e-94
PFAM Definition: I_LWEQ, I/LWEQ domain. I/LWEQ domains bind to actin. It has been shown that the I/LWEQ domains from mouse talin and yeast Sla2p interact with F-actin. I/LWEQ domains can be placed into four major groups based on sequence similarity: (1) Metazoan talin; (2) Dictyostelium TalA/TalB and SLA110; (3) metazoan Hip1p; and (4) yeast Sla2p. The domain has four conserved blocks, the name of the domain is derived from the initial conserved amino acid of each of the four blocks..
Pfam Number: pfam01608 Score: 629 E_value: 5e-66
Swissprot: Q9P6L5|SLA2_SCHPO
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0032153 = Cellular component: cell division site
GO:0005515 = Molecular function: protein binding
GO:0042815 = Biological process: bipolar cell growth
GO:0030866 = Biological process: cortical actin cytoskeleton organization and biogenesis
GO:0006897 = Biological process: endocytosis
GO:0030950 = Biological process: establishment and/or maintenance of actin cytoskeleton polarity
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0031505 = Biological process: fungal-type cell wall organization and biogenesis
GO:0008104 = Biological process: protein localization

Sequence:
>Contig1803
GAATCCCCTATGAATGCAGGTAATCAGAGTGCATCGCCCGGTTATTTACT
TTCCCAGATTGAGAAGGCCCAAATGAGCGCTACCGAGTTTGCCACCTCGT
TCAATCACTTTATCGCGGATGGGCCCAATAGCACACAGTCTCAAATCATC
AAGACGCTTCATGTGTTTGCTGGTGCCATCGCGGATGTGCTCGCGAATGC
CAAAGGTGTTACACGGTTTGCTCCGGATGAGAGGAGAAGCGAAGCCATCT
TGTCATCCGCGCGACAGTCTGCGGGAACCGCTGTGAAATTCTTCCAGAAC
CTCATGTCTTTCCGATTAGATGATTTGAGTGTCGACCGCAAAACCGATAT
TGTCGTTTCCAGCAATCTTGAAGTCCAGAAACACTTGCAGAAGCTGAACA
AGCTTGCCGAGCAATTCATGGCTAAGGGTGGTTCCGATCTGTCAAAGGCA
AGTGGGGATCTTGGAGACGTCGTCGATGCAGAGATGAATAAGGCGGCTGC
AGCAATTGAGGCCGCTACAGCCCGCCTAGCGCAGCTTATGAAGAAGCCCA
AGAACCCAGGTTATTCAACCTTTGAAATCAGCATTCACGATTCAATTTTA
GACGCCGCTATTGCGGTTACCAATGCTATCGCTCAGTTGATCAAGGCTGC
CACGGTTTCGCAGCAAGAGATTGTGGCACAAGGGAGAGGCAGCAGTTCCC
GTACTGCATTTTACAAGCGTAACAATCGCTGGACCGAGGGGCTGATTTCA
GCAGCCAAGGCTGTCGCCATGTCCACAAACATGTTGATTGAGACCGCCGA
TGGTGTTATCAGTGGCCATAAAAAGCTTGAACAACTGATCGTCGTTGCCA
ACGATGTTGCCGCGTCTACCGCACAACTTGTAGCCGCATCGCGTGTTAAG
GCATCATTCATGTCCAAGTCACAAGAGCGTCTGGAGGCCGCATCAAAAGC
CGTCACAAGCGCGTGCAAATCCCTCGTCCGACAAGTTCAGGACATCATTT
CCGCTAAGAACCGTGAAGAGAATGAAGATGTGGACTACTCCAAACTAACC
TCGCACGAGTTCAAAGTTCAGGAAATGGAGCAACAGGTCGAAATCCTACA
ACTAGAAACCCAATTGCAGCAACCACGCCAGAGACTCGGAGAAATGAGAA
AGCACTCGTATGCGCAGGATCAGGACTAATTTGTTATTTGGGTTTTTTTT
CCTTTTCTATTTGTCTGGGAGGGGGAGGGGAGCTAGAGCGTATCGATCCT
CTTTTTTGATCGGCGCAGTTGGTTGGGTAACTTTGCGTTCTTCGTCACTT
TTTTTCTTTCTAGCTTCCAAACCTTTAGCGGATTATTTGTAGCTCTCGAA
CTATTCACCTCCTGTG

Sequences in the Contig:

SY0AAA62YM15FM1 SY0AAB60YG22FM1 SY0AAD24YM12FM1
SY0AAD40YD04FM1