Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1802
Length(NT) : 647
Best Gene Model Blast : Link to GSTUMT00005433001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: COPII-coated vesicle protein (Erv41), putative
Accession: ref|XP_001265713.1| Score: 308 E_value: 1e-26
KEGG Definition: hypothetical protein
Accession: ang:An03g04940 Score: 298 E_value: 7e-26
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2667 Score: 246 E_value: 5e-22
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 106 E_value: 7e-06
Swissprot: Q04651|ERV41_YEAST
Gene Ontology:
GO:0030134 = Cellular component: ER to Golgi transport vesicle
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane
GO:0030173 = Cellular component: integral to Golgi membrane
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport

Sequence:
>Contig1802
TTGGCTCCAATCTTGACCTAAAATCTCTGCCACCACCACCACCACCACAA
ACCCCACTAATGCAACAATGAACGAAGAATTCTTTGGTGAAAAGCGCACC
TCTCTCGGCGAGAGCGTGCGCACCTTTGATGCCTTCCCAAAAACTCGAGC
AACGTACACAACCCGCACCCCCCGCGGCGGCGCAATCACCCTCCTCCTCC
TGCTTACCAGCGCCTGCCTGACCCTCACGGAGCTGCGAAACTACCTGACG
GGCAGCGAGTCGCACACATTCATGGTGGAGCCGGGCATCGGGCACGACAT
GCAGATAAACCTCGACATAACGGTGGCCATGCCGTGCTCGAGCCTGCACC
TGAATGTGCAGGACGCGATGCAGGACCGCATACTGGCCGGGGAATTGCTG
TCGCGGGAGGAGGTGTGGTTCGACGATGCGGGCGCGCACAAGCTCTACTC
GGAGGGTGCGGATGCGGAAACGGAGCGACGTGTCTACGAGGTCCTCAGGA
AGGGGGGGAAGAAGGGTGGGTTCAAGAAGGGTGGGGGGAGGAAGGGAGGT
TTGTTCTCCTCGTTGGTGGGGAAGGGCGCGGGCGAGGGTGGGGGGAGTTG
CAGGATTTATGGGAGTATGGGGGTTAATCGGATTCTGGGCGATTTCC

Sequences in the Contig:

SY0AAA16YI17FM1 SY0AAA62YK17FM1 SY0AAB13YN03FM1
SY0AAB38YG03FM1 SY0AAB49YG01FM1 SY0AAB8YL04FM1
SY0AAC1YF09FM1 SY0AAC61YM09FM1 SY0AAD20YA11FM1